How are the sensory receptors classified, Biology

Assignment Help:

According to the stimuli they collect how are the sensory receptors classified?

The sensory receptors are divided according to the stimuli they get: mechanoreceptors are stimulated by pressure (e.g., touch or sound); chemoreceptors respond to chemical stimuli (olfactory, pH, taste, metabolite concentration, etc.);

 


Related Discussions:- How are the sensory receptors classified

What is the function of the feet in molluscs, Q. What is the function of th...

Q. What is the function of the feet in molluscs? How is the mollusc foot related to the name given to the classes of the phylum? The mollusc foot has the function of support, l

Define ailing and failing, Define ailing and failing Clinically unhealt...

Define ailing and failing Clinically unhealthy implants are classified as "ailing" or "failing". It is necessary to distinguish between an ailing versus a failing implant to de

Animal versus plant metabolism, Which of the following BEST characterizes g...

Which of the following BEST characterizes gas exchange in animal versus plant metabolism: Animals take in O2 and release CO2. Plants take in and release both O2 and CO2. Both anima

State the series of stimuli, State the series of stimuli ERPs a series ...

State the series of stimuli ERPs a series of stimuli such as tones or light flashes are presented to the participant, and the raw EEG for a precise one or two second period fol

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

How many cellular nuclei does the pollen tube of angiosperms, Q. How many c...

Q. How many cellular nuclei does the pollen tube of angiosperms have? What is ploidy of each of these nuclei? The pollen tube explicitly the mature male gametophyte of angiospe

What do you meant by medical transcriptionist, Question 1: Describe the...

Question 1: Describe the process of hearing. The ear consists of three basic parts - the outer ear, the middle ear, and the inner ear. Discuss the process of hearing

What is gastrulation, Q. What is gastrulation? How during gastrulation are ...

Q. What is gastrulation? How during gastrulation are the first two germ layers formed? What are these germ layers? Gastrulation is the process through which a portion of the bl

Non-muscular movement, NON-MUSCULA R MOVEMENT - 1 .      Streaming m...

NON-MUSCULA R MOVEMENT - 1 .      Streaming movement - In amoeba, cyclosis is common. 2 .      Pseudopodial - In leucocyte, macrophages, amoeboid movement take place

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd