Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
According to the stimuli they collect how are the sensory receptors classified?
The sensory receptors are divided according to the stimuli they get: mechanoreceptors are stimulated by pressure (e.g., touch or sound); chemoreceptors respond to chemical stimuli (olfactory, pH, taste, metabolite concentration, etc.);
Q. What is the function of the feet in molluscs? How is the mollusc foot related to the name given to the classes of the phylum? The mollusc foot has the function of support, l
Define ailing and failing Clinically unhealthy implants are classified as "ailing" or "failing". It is necessary to distinguish between an ailing versus a failing implant to de
Which of the following BEST characterizes gas exchange in animal versus plant metabolism: Animals take in O2 and release CO2. Plants take in and release both O2 and CO2. Both anima
State the series of stimuli ERPs a series of stimuli such as tones or light flashes are presented to the participant, and the raw EEG for a precise one or two second period fol
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. How many cellular nuclei does the pollen tube of angiosperms have? What is ploidy of each of these nuclei? The pollen tube explicitly the mature male gametophyte of angiospe
Question 1: Describe the process of hearing. The ear consists of three basic parts - the outer ear, the middle ear, and the inner ear. Discuss the process of hearing
Q. What is gastrulation? How during gastrulation are the first two germ layers formed? What are these germ layers? Gastrulation is the process through which a portion of the bl
NON-MUSCULA R MOVEMENT - 1 . Streaming movement - In amoeba, cyclosis is common. 2 . Pseudopodial - In leucocyte, macrophages, amoeboid movement take place
N-linked glycosylation in ER
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd