How are gases exchanged in sponges, Biology

Assignment Help:

How are gases exchanged in sponges?

The gas exchange in sponges occurs by diffusion from the external to the cells that absorb molecular oxygen and release carbon dioxide.

Related Discussions:- How are gases exchanged in sponges

What are the main parts of ferns, What are the main parts of ferns? Fer...

What are the main parts of ferns? Ferns are constituted by small roots that come downwards from the rhizome (stem, often orizontalized). The fronds also arise from the rhizome.

Define the term behaviour change communication, Q. Define the term Behaviou...

Q. Define the term Behaviour Change Communication? Behaviour Change Communication (BCC) is an interactive process with communities to develop specific messages and methods usin

Show the principle parts of a mold, Q. Show the principle parts of a mold? ...

Q. Show the principle parts of a mold? The principle parts of a mold are a web-like structure known as mycelium and the spore. The mycelium is often white and cottony and penet

What is resective therapy, Resective therapy Is used to reduce pockets,...

Resective therapy Is used to reduce pockets, correct negative osseous architecture and rough implant surfaces and increase the area of keratinized gingival if needed. Apical

Define sporangiophore - types of hyphae, Define Sporangiophore - Types of H...

Define Sporangiophore - Types of Hyphae? Sporangiophore - Tufts of special, erect unbranched, hyphae growing in air arise from stolon just opposite to rhizoids. These are s

Energy demand for sedentary or light activity lifestyles, Explain Energy de...

Explain Energy demand for Sedentary or Light Activity Lifestyles? These people have occupations that do not demand much physical effort, are not required to walk long distances

Define about the absorption of iron, Define about the Absorption of Iron? ...

Define about the Absorption of Iron? Before it can be absorbed, iron whether it is in the form of haem or non-haem must be released from the food matrices where it is bond with

On average what is the life duration of the red blood cells, On average wha...

On average what is the life duration of the red blood cells? Where are they destroyed? What is the destination of the heme groups after the destruction of hemoglobin molecules?

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Growing leaves in the classroom, Growing leaves in the classroom A swee...

Growing leaves in the classroom A sweet potato will make dense foliage in the classroom if it is placed in water. Set the potato, root end down, in a glass or jar and keep the

Write Your Message!

Name

Email id

Message

Verfication Code

User Account

All Pages