Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
What would be the likely immune response ability of an individual with a deletion of a Class II gene of the MHC on one chromosome and a nonsense mutation at the beginning of the same gene on the homologue?
Preference Share Capital or Quasi-Equity It is also called quasi-equity because it combines features of equity and those of debt. It is preference because it is preferred to
what do our brain and heart do when we are asleep?
EXCRETIO N IN EARTHWORM - Main organs are nephredia, pharyngeal, integumentary & septed nephredia. Main are septal nephredia situated on septa.Nephrostome present. Body
Explain Alternate Photosynthetic Pathways? An alternate photosynthetic pathway is the C4 pathway, where plants incorporate carbon into four-carbon compounds instead of 3PG. Thi
Q What are the major functions of the blood? The blood is a means of substance transportation throughout the body. The blood distributes hormones, nutrients, oxygen, cells and
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
PHOSPHORUS It is present in vegetables, grains (oat metal, wheat meal), milk, eggs, cheese, meat, fish, etc. It helps in - (a) Like calcium it is a constituent of bones.
Q. Define the term Behaviour Change Communication? Behaviour Change Communication (BCC) is an interactive process with communities to develop specific messages and methods usin
Which biological molecule contains the genetic information that controls cellular functioning
what is nomenalistic specie concept
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd