Homologue, Biology

Assignment Help:

What would be the likely immune response ability of an individual with a deletion of a Class II gene of the MHC on one chromosome and a nonsense mutation at the beginning of the same gene on the homologue?


Related Discussions:- Homologue

Preference share capital or quasi-equity, Preference Share Capital or Quasi...

Preference Share Capital or Quasi-Equity It is also called quasi-equity because it combines features of equity and those of debt.  It is preference because it is preferred to

Dreams, what do our brain and heart do when we are asleep?

what do our brain and heart do when we are asleep?

Excretion in earthworm, EXCRETIO N IN EARTHWORM - Main organs are neph...

EXCRETIO N IN EARTHWORM - Main organs are nephredia, pharyngeal, integumentary & septed nephredia. Main are septal nephredia situated on septa.Nephrostome present. Body

Explain alternate photosynthetic pathways, Explain Alternate Photosynthetic...

Explain Alternate Photosynthetic Pathways? An alternate photosynthetic pathway is the C4 pathway, where plants incorporate carbon into four-carbon compounds instead of 3PG. Thi

What are the major functions of the blood, Q What are the major functions o...

Q What are the major functions of the blood? The blood is a means of substance transportation throughout the body. The blood distributes hormones, nutrients, oxygen, cells and

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Phosphorus - mineral elements, PHOSPHORUS It is present in vegetables, ...

PHOSPHORUS It is present in vegetables, grains (oat metal, wheat meal), milk, eggs, cheese, meat, fish, etc. It helps in - (a) Like calcium it is a constituent of bones.

Define the term behaviour change communication, Q. Define the term Behaviou...

Q. Define the term Behaviour Change Communication? Behaviour Change Communication (BCC) is an interactive process with communities to develop specific messages and methods usin

Protein synthesis, Which biological molecule contains the genetic informati...

Which biological molecule contains the genetic information that controls cellular functioning

Specie concept, what is nomenalistic specie concept

what is nomenalistic specie concept

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd