Homologous structures, Biology

Assignment Help:

Homologous structures are the body parts in different organisms which have similar bones and similar arrangements of the blood vessels, muscles, and nerves and go through similar embryological development, but do not necessarily serve the same function; for example the þipper of a whale and the forelimb of a horse.


Related Discussions:- Homologous structures

What is malnutrition, What is malnutrition? Malnutrition can be defined...

What is malnutrition? Malnutrition can be defined as a pathological condition resulting from a relative or absolute deficiency or excess of one or more of the essential nutrien

Phylum protozoa, hints for preparing for college assignment any outline

hints for preparing for college assignment any outline

Zoology, give detail account of modes of locomotion in protozoa and describ...

give detail account of modes of locomotion in protozoa and describe various type of asexual reproduction in protozoa

Management of soil productivity, Management of soil productivity The co...

Management of soil productivity The continuous prosperity and well being of the people of any nation is dependent upon several factors, one of the most important being the leve

Single stranded conformation polymorphism analysis, This is a broadly used ...

This is a broadly used screening technique that find several genomic mutations in wide number of samples, this technique finds sequence variations because of point mutations or oth

Inrinsic conduction system of the heart, The cardiovascular system controls...

The cardiovascular system controls the movement of blood through thousands of miles of capillaries so that every tissue  in every part of the body is perfused. Essential nutrients

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain the formation of the enzyme-substrate complex, What are the main th...

What are the main theoretical models that try to explain the formation of the enzyme-substrate complex? There are two major models that explain the formation of the enzyme-subs

Which is better to grow plants in rock sand or soil, Explain which is bette...

Explain which is better to grow plants in Rock sand or soil? Ans) When we grew plants inside, with no wind, and the plants in the rocks grew superior to the plants that were gr

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd