Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The state of balance in the internal environment of the body it includes control of the water balance of the blood, body temperature, blood sugar level and blood urea level. Each of these internal factors is maintained by a separate mechanisms the central nervous system and the endocrine system. Before these systems can bring about any change they have to be supplied with information regarding the body state. Living cells and all the chemical reactions are controlled by enzymes; the enzymes are very sensitive to the conditions in which they work (PH). A slight fall in temperature or a rise in acidity may slow down or stop an enzyme from working and thus prevent an important reaction from taking place in the cell.
Cell membrane controls the substances which enter and leave the cell, but it is the tissue fluid which supplies or removes these substances, and it is therefore important to keep the composition of the tissue fluid as steady as possible. If the tissue fluid were too concentrated, it would withdraw water from the cells by osmosis and the body would be dehydrated. If the tissue fluid were too dilute, the cells would take up too much water from it by osmosis and the tissues would become waterlogged and swollen.
What is the role of mitosis in growth?
Explain the Photosensitive Detectors? A wide range of detectors varying in senstivity and cost are available. They contain a light sensitive surface that releases electrons in
Endocrine System In endocrine system ductless gland or specialized cells release chemicals called hormones into the circulating blood. These hormones influence the functions of
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
What is the clinical deficiency presented by hemophilic people? What is the genetic cause of that deficiency? The Hemophilia is a disease characterized by impaired blood clotti
Who did EPA consult with outside of the Agency in making this rule? EPA consulted with many agencies, organizations, and individuals in the process of finalizing the plant- inc
Solar Tracking - Nastic and Epinastic Responses Many plants such as sun flowers are capable of solar tracking in which the flat blade of leaves or inflorescence will remain a
Define Changes in Tract Minerals - Nutrition during Stress? Changes in the balance of magnesium, phosphate, zinc and potassium follows alterations in nitrogen balance. Iron and
Excluding the effects of cardiac output and hormones, describe the other factors that may affect blood pressure and blood flow in a middle-aged man who is exercising in an aerobics
Explain about the Cancer and Infertility - Obesity? Cancer: Risk of cancers of the colon, rectum and prostrate increases greatly in obese men while obese women are more likely
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd