Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Each of the three eukaryotic RNA polymerases has more subunits or 12 and so these are big complex enzymes. The genes encoding some of the subunits of each eukaryotic enzyme show
What is gluconeogenesis There is accumulation of lactate, which is released into the blood and taken up by the liver where it is converted to glucose by the process called
Omni Science Valve : This is another type of tilting disc valve available from 1978. The cage is made of titanium and disc out of pyrolitic carbon. There have been a
Sucrose is a non-reducing Sugar while Maltose and Lactose are reducing due to the presence of free Aldehydic Functional Group in them. In SUgar the Aldehydic Group of both Glucose
What is genetic equilibrium? The Genetic equilibrium is the result of the Hardy-Weinberg law, a principle that affirms that under specific conditions the frequencies of the all
Tropical seasonal forests - Ecosystem Tropical seasonal forests occur in regions where total annual rainfall is very high but segregated into pronounced wet and dry periods. T
Questiion 1 List various methods used for hemoglobin estimation of donor. Add a note on specific gravity method Question 2 Why is it important to follow safety measures
Explain Environmental Factors influencing food production? You probably know that no agricultural region has a constant climate throughout the year. This is true even in the tr
Q How do antagonistic mechanisms manage homeostatic regulation? The homeostatic maintenance of the body typically occurs by means of alternating antagonistic compensatory mecha
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd