Hemoconcentration, Biology

Assignment Help:

Hemoconcentration

Before, during and after CPB, hemoconcentration allows the patient's blood to be salvaged during surgery to help reduce the need for donor blood. Ultra filtration during or after CPB allows for removal of plasma water. This preserves all blood components allowing whole blood reinfusion. Centrifugation helps for reinfusion of concentrated red blood cells.


Related Discussions:- Hemoconcentration

Discuss the role of nadph in erythrocytes, Discuss the role of NADPH in ery...

Discuss the role of NADPH in erythrocytes The fragility of erythrocytes  is impaired in the absence of NADPH generation due to the deficiency of glucose-6-phosphate dehydrogena

What type of bonds is susceptible to hydrolysis, What type of bonds is susc...

What type of bonds is susceptible to hydrolysis? Book examples are C-N and C-OH.

Explain the work of linnaeus in animal taxonomy, Explain the work of Linnae...

Explain the work of Linnaeus in animal Taxonomy? In 18th century, the work of Linnaeus and his followers (Haartman, 1751, 1764, Kolreuter, 1761-66) helped systematic to advance

Describe the recovery process of an extracellular product, Question 1: ...

Question 1: Describe the recovery process of an extracellular product through downstream processing. Different criteria's for the choice of recovery process Brief on

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain the pipettes - food microbiology, Explain the Pipettes - Food Micro...

Explain the Pipettes - Food Microbiology? Sterile glass pipettes or disposable pipettes can be used for transferring the known volume of liquid or culture aseptically. Steriliz

Difference between anaerobic and aerobic beings, Q. What is the difference ...

Q. What is the difference between anaerobic and aerobic beings? Anaerobic organisms are those that live or can live under oxygen-lacking environments and Aerobic organisms are

Floral apex, Floral Apex Each plant must pass through a minimal 'ripe...

Floral Apex Each plant must pass through a minimal 'ripeness to flower' stage. That is, even to perceive and respond to a specific photoperiodic regime, a plant must be ready

Explain the conveyor (or band) dryers, Explain the Conveyor (or Band) Dryer...

Explain the Conveyor (or Band) Dryers? In the conveyor (or band) dryer, the product is distributed on a moving belt, typically of a perforated plate, that passes through a tunn

Surface markings of the heart, The Upper Border of the Heart A:  Mark a ...

The Upper Border of the Heart A:  Mark a point on the lower border of the left second costal cartilage 1.2 cm away from the sternal margin. B:  Mark a point on the upper bord

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd