Hazard, Biology

Assignment Help:

Hazards Is an event whether natural or man-made that has potential for causing injury, loss of life and damage to the property or the environment. It can be grouped into two broad categories, namely natural and man-made.

Earth quakes, volcanic eruptions, tsunamis etc. are the examples of natural hazards which have a natural origin whereas man made hazards are those which occur due to human negligence, war, explosion of bombs, industrial pollution, industrial accidents, leakage of toxic wastes, dam failure, rail, road and air accidents are some examples of man-made hazards.

Some forms of  hazard like landslides, floods, droughts and fires fall under the category of both natural and man-made hazards for instance-flooding can take place because of heavy rain which is a natural phenomenon or may be due to lack of drainage facility which is the result of human negligence.

If a hazards cause multiple casualties, it may be termed as a multiple hazards for example-if an earthquake causes landslides and consequently the flow of river is hindered, resulting in floods, then it is a multiple hazard.

Area of hazards:   different types of hazards occur in different areas for example earthquakes, landslides; avalanches are more common in mountainous regions while cyclones, floods are prevalent in coastal areas. Similarly, sandstorms take place in desert areas while droughts mostly occur in plateau region.

 

 


Related Discussions:- Hazard

Why nutrition is important for health, Why Nutrition is important for healt...

Why Nutrition is important for health Nutrition is one of the basic components of  life. It is an essential part of health care. You already know that good nutrition  is essent

Central carbons participate in the union between amino acids, Q. Do the -R ...

Q. Do the -R groups bound to the central carbons participate in the union between amino acids? The peptide bond attaches the nitrogen of the amine group of one amino acid to th

Ethylene - plant growth substances, Ethylene - Plant Growth Substances ...

Ethylene - Plant Growth Substances This hydrocarbon C 2 H 2 is a gas and is unbelievably a small and simple molecule to be accepted as a hormone. Ethylene is not produced by

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain insect resistant crops - evolutionary, Insect resistant crops (IRC)...

Insect resistant crops (IRC) Insects are a natural selection pressure so plants resistant to certain insects could have an evolutionary advantage (in natural environments)

Explain food lipids, Explain Food lipids It is either consumed in the ...

Explain Food lipids It is either consumed in the form of "visible" fats, which have been separated from the original plant or animal sources, such as vegetable oil and butter,

What is choanocytes, Which one of the following statements about all the fo...

Which one of the following statements about all the four of Spongilla, Leech, Dolphin and Penguin is correct? 1. Penguin is homiothermic while the remaining three are poikilothe

Effects of malnutrition, Effects of malnutrition The effects of maln...

Effects of malnutrition The effects of malnutrition are not the same in adults and children. When the amount of food is not sufficient or when the nutrients are missing f

Joints, JOINTS - The structural arrangement of tissues which connect 2 ...

JOINTS - The structural arrangement of tissues which connect 2 or more bones together at their place of meeting is called a joint. Study of joint is arthrology. Joint make the

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd