Haploid production, Biology

Assignment Help:

Haploid Production

The higher plants are normally diploid, with two sets of chromosomes in their somatic cells. Their haploids (with one set of chromosomes) arise in nature by parthenogenesis due to malfunction in the normal sexual process. However, such events are extremely rare and unpredictable. In 1964, two Indian scientists, Guha and Maheswari, observed that in cultured anthers of Datura innoxia some of the microspores, instead of following the normal gametophytic mode of development, formed sporophytes (Androgenic plants).

As expected, those sporophytes were haploid. This report caused much excitement because of the considerable importance of haploids in genetics and plant breeding. To-date androgenic haploids of over 200 species, including many major crop plants (Cereals, Brassica spp, tomato and potato), have been raised through anther and/or isolated pollen culture.


Related Discussions:- Haploid production

Define hormonal imbalance as a factor for obesity, Define Hormonal imbalanc...

Define Hormonal imbalance as a factor for obesity? Certain diseases associated with secretion of hormones, e.g., hypothyroidism, hypogonadism and Cushing's syndrome exhibit obe

Why is the uricotelic excretion essential for reptile, Q. Why is the uricot...

Q. Why is the uricotelic excretion essential for reptile and avian embryos? In birds and reptiles the excretory system is uricotelic since uric acid is less toxic, insoluble an

Briefly explain endocrine system, Q What is the constitution of the endocri...

Q What is the constitution of the endocrine system? The endocrine system is constituted by the hormones and the endocrine glands they secrete. Q. What is the histological n

Haustorial behavior of embryo sac, Haustorial Behavior of Embryo Sac ...

Haustorial Behavior of Embryo Sac There are instances in which the entire embryo sac may grow beyond the ovular tissue. The central cell may also form multicellular projectio

Is protein collagen has a high proportion of glycine, The protein collagen ...

The protein collagen has a high proportion (20% or more) of A. asparagine and glutamine B. proline and hydroxyproline C. glycine D. both A and B E. both A and C F

Explain pr murmur characterstic and graham steel murmur, Explain PR Murmur ...

Explain PR Murmur characterstic and graham steel murmur? PR Murmur Characteristic: Blowing, decrescendo murmur heard loudest in 2nd and 3rd left intercostal space with increa

Define economic evaluation of malnutrition, Define Economic Evaluation of M...

Define Economic Evaluation of Malnutrition? You must be familiar with a proverb frequently used in the field of economics, which says - "resources are limited and wants are unl

#title, Feeding mechanism in holozoic organisms

Feeding mechanism in holozoic organisms

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Why are grasshopper is said to show male heterogamity, a) Why are grasshopp...

a) Why are grasshopper and Drosophila said to show male heterogamity? Describe. b) Define female heterogamity with the help of an example.

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd