Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Haploid Production
The higher plants are normally diploid, with two sets of chromosomes in their somatic cells. Their haploids (with one set of chromosomes) arise in nature by parthenogenesis due to malfunction in the normal sexual process. However, such events are extremely rare and unpredictable. In 1964, two Indian scientists, Guha and Maheswari, observed that in cultured anthers of Datura innoxia some of the microspores, instead of following the normal gametophytic mode of development, formed sporophytes (Androgenic plants).
As expected, those sporophytes were haploid. This report caused much excitement because of the considerable importance of haploids in genetics and plant breeding. To-date androgenic haploids of over 200 species, including many major crop plants (Cereals, Brassica spp, tomato and potato), have been raised through anther and/or isolated pollen culture.
Define Hormonal imbalance as a factor for obesity? Certain diseases associated with secretion of hormones, e.g., hypothyroidism, hypogonadism and Cushing's syndrome exhibit obe
Q. Why is the uricotelic excretion essential for reptile and avian embryos? In birds and reptiles the excretory system is uricotelic since uric acid is less toxic, insoluble an
Q What is the constitution of the endocrine system? The endocrine system is constituted by the hormones and the endocrine glands they secrete. Q. What is the histological n
Haustorial Behavior of Embryo Sac There are instances in which the entire embryo sac may grow beyond the ovular tissue. The central cell may also form multicellular projectio
The protein collagen has a high proportion (20% or more) of A. asparagine and glutamine B. proline and hydroxyproline C. glycine D. both A and B E. both A and C F
Explain PR Murmur characterstic and graham steel murmur? PR Murmur Characteristic: Blowing, decrescendo murmur heard loudest in 2nd and 3rd left intercostal space with increa
Define Economic Evaluation of Malnutrition? You must be familiar with a proverb frequently used in the field of economics, which says - "resources are limited and wants are unl
Feeding mechanism in holozoic organisms
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
a) Why are grasshopper and Drosophila said to show male heterogamity? Describe. b) Define female heterogamity with the help of an example.
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd