Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Haemodynamics : The type of valves chosen should have excellent haemodynamics. In studies at rest and on exercise the valve should produce only acceptable diastolic gradients in the mitral position and systolic gradient in the aortic position. This will depend mainly on the effective orifice area (EOA) of the particular valve.
Prosthetic Valve haemodynamics
A high profile valve like Starr-Edward may cause problems if not properly used. In mitral stenosis with small left ventricle such a valve is better avoided. Similarly when the ascending aorta is narrow it has to be enlarged to accommodate a Stm-Edward valve.
Q. What are the hormones secreted by the adenohypophysis? What are their respective functions? The ACTH (adrenocorticotropic hormone), adenohypophisys secretes GH (growth hormo
Explain Blood Vessels that carry blood? Blood vessels that carry blood away from the heart to the lungs or to the rest of the body are called arteries. The walls of arteries ha
Explain Coarctation of Aorta ? Coarctation of aorta may be isolated or it may have other co-existing cardiac and vascular lesions. In critically ill neonates with coarctation,
Fruits Diabetics should have fruits every day. Be careful to select fruits and fruit juices, citrus fruits, such as oranges, grapefruit should be included. Tell them to eat fru
Q. What is the structure through which the neural impulse is transmitted from one cell to another? What are its parts? The structure through which the neural impulse passes fro
Describe the process of biosynthetic phase of photosynthesis occurring in the chloroplast. Explain the process of development of root nodules in a leguminous plant. Name the ox
Long buccal nerve The long buccal nerve is a branch of the mandibular division of the trigeminal nerve which provides sensory innervation to the buccal gingiva and mucosa of th
Manual and Automatic Toothbrushes Brushing is imperative and soft or medium toothbrushes are recommended. Small heads are useful because they allow better access. Automatic too
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
How is snow - blindness caused in humans? a) Mention the site where syngamy happens in amphibians and reptiles correspondingly.
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd