Haemodynamics, Biology

Assignment Help:

Haemodynamics :  The type of valves chosen should have excellent haemodynamics. In studies at rest and on exercise the valve should produce only acceptable diastolic gradients in the mitral position and systolic gradient in the aortic position. This will depend mainly on the effective orifice area (EOA) of the particular valve.

Prosthetic Valve haemodynamics

252_Prosthetic Valve haemodynamics.png

A high profile valve like Starr-Edward may cause problems if not properly used. In mitral stenosis with small left ventricle such a valve is better avoided. Similarly when the ascending aorta is narrow it has to be enlarged to accommodate a Stm-Edward valve.


Related Discussions:- Haemodynamics

Which hormones secreted by the adenohypophysis, Q. What are the hormones se...

Q. What are the hormones secreted by the adenohypophysis? What are their respective functions? The ACTH (adrenocorticotropic hormone), adenohypophisys secretes GH (growth hormo

Explain blood vessels that carry blood, Explain Blood Vessels that carry bl...

Explain Blood Vessels that carry blood? Blood vessels that carry blood away from the heart to the lungs or to the rest of the body are called arteries. The walls of arteries ha

Explain coarctation of aorta, Explain Coarctation of Aorta ? Coarctati...

Explain Coarctation of Aorta ? Coarctation of aorta may be isolated or it may have other co-existing cardiac and vascular lesions. In critically ill neonates with coarctation,

Who is fruits useful for diabetics patients, Fruits Diabetics should ha...

Fruits Diabetics should have fruits every day. Be careful to select fruits and fruit juices, citrus fruits, such as oranges, grapefruit should be included. Tell them to eat fru

How neural impulse is transmitted from one cell to another, Q. What is the ...

Q. What is the structure through which the neural impulse is transmitted from one cell to another? What are its parts? The structure through which the neural impulse passes fro

Explain the process of biosynthetic phase, Describe the process of biosynth...

Describe the process of biosynthetic phase of photosynthesis occurring in the chloroplast. Explain the process of development of root nodules in a leguminous plant. Name the ox

Determine the long buccal nerve, Long buccal nerve The long buccal nerv...

Long buccal nerve The long buccal nerve is a branch of the mandibular division of the trigeminal nerve which provides sensory innervation to the buccal gingiva and mucosa of th

Explain about manual and automatic toothbrushes, Manual and Automatic Tooth...

Manual and Automatic Toothbrushes Brushing is imperative and soft or medium toothbrushes are recommended. Small heads are useful because they allow better access. Automatic too

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

How is snow - blindness caused in humans, How is snow - blindness caused in...

How is snow - blindness caused in humans? a) Mention the site where syngamy happens in amphibians and reptiles correspondingly.

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd