Green house effect and global warming, Biology

Assignment Help:

The Term "Green House" effect was first introduced by j. Fourier in 1827. The green house effects are the rise in temperature of earth because certain gases in the atmosphere (CO2, NO, CH4 and water vapour) absorb energy of sum.

The phenomenon is known as green house effect due to it's similarly to the heat trapping effect of glass walls in horticulture green house. In the green house visible light passes through glass and heats up soil and other soil structure. The soil emits I.R. radiations of long wavelength which are reflected back or partly absorbed by glass. This keeps the green house worm and cozy for growth of plants.

The earth atmosphere act like a glass in house. The sum is the ultimate source of energy on earth. Most of this energy is absorbed by soil, rock, and water to increase the temperature of earth's surface. Some of this energy is utilized by plant for photosynthesis process; rest of this energy is reflected back into space. At the night this energy is reradiated from the heated surface.

Mainly as infrared radiations, certain gases such as CO2, CH4, (known as green house gas) CFC'S form a blanket around the earth surface and absorb the reradiated I.R. rays and cause heating up of the earth and its environment. This is known as green house effect or global warming.

Certain optimum level of green house gases is essential to maintain desired temperature of earth to regulate life on this earth. Life on this planet is not possible without green house effect and average temperature would have been as low as -18 0C.

But due to industrialization, revolution in automobile industry the concentration of green house gases is increasing constantly. As a result of higher conc. of green house gases, scientists predict that the earth's atmosphere will be warmer and lead to global warming. It is being predicted that if proper precautions are not taken, the conc. Of green house gases in the atmosphere may double in next 50 years and may lead to increase in global temp by 4 to 50C

Effects of global warming:

1.      Temperature changes: it is being predicted by computer modeling studies that if CO2 concentration is double then there is rise of 1 to 30C of global temperature from the pre-industrial time to present. At present CO2 concentration has already increased 29%.

2.      Melting of polar ice cap: the increased temperature would lead to melting of glaciers and polar ice caps.

3.      Rising of sea level: melting of glaciers and polar ice caps, increases the level of seas and oceans and causes flooding of low lying regions.

4.      Climate changes: in the temperate regions the winter will be shorter and warmer and the summer will be longer and hotter. The tropics may become water and the sub-tropics which are already dry are expected to be drier.

5.      Increase in average temperature of earth will disturb the ecosystem, affect crop production, and disturb food chain and water supplies.


Related Discussions:- Green house effect and global warming

What is soil fertility evaluation, Soil fertility evaluation  In order ...

Soil fertility evaluation  In order to maintain soil fertility, nutrients removed from the soil by crops must be restored by the application of manures and fertilizers.  The se

#nervous system, 6. What is the function of the myelin sheath? Do all axons...

6. What is the function of the myelin sheath? Do all axons present a myelin sheath?

Alcohol consumption by diabetes patient, Q. Alcohol consumption by diabetes...

Q. Alcohol consumption by diabetes patient? Intake of alcohol should be limited. It is high in calories, lacks essential nutrients and may therefore promote ketoacidosis, hyper

The main causes of the loss of biological diversity, What are the main caus...

What are the main causes of the loss of biological diversity nowadays? The biggest dangers to biological diversity today are the action of humans. The most of them is the destr

When a fatty acid reacts with thew glycerol, When a fatty acid reacts with ...

When a fatty acid reacts with glycerol, the result is- Select one: a. Formation of an amide b. Formation of an ester c. Formation of hydrocarbon d. Formation of a th

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Food texture and gas formers, Q. Food texture and Gas formers? Food tex...

Q. Food texture and Gas formers? Food texture: Recent studies indicate that strict omission of fibre is of no help on a peptic ulcer patient. The recurrence of peptic ulcer was

Define distant osteogenesis, Q. Define Distant Osteogenesis? Distant Os...

Q. Define Distant Osteogenesis? Distant Osteogenesis : This type of healing has also been described to explain the phenomenon of "Osseointegration" of machined metallic implant

What are the applications of nicotinic acid, What are the Applications of N...

What are the Applications of Nicotinic acid Nicotinic acid is mainly used in the vitamin fortification of flour, macaroni and noodle products. Independent of its vitamin effic

Concept of universality of the genetic code, Q. What is the concept of univ...

Q. What is the concept of universality of the genetic code? What are the exceptions to this universality? The genetic code is universal because the rules of protein codificatio

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd