Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Glycogenesis: This is an anabolic process in which glucose is polymerized into glycogen by the sequence of reactions. Since glycogenesis occur in all body cells .but its main sites are liver and skeletal muscles. Liver and muscle cells remove excess glucose from blood and polymerize it into glycogen for storage .About 400 grams of storage glycogen is normally found in human body.
Endospores are found in prokaryotes or eukaryotes?
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. Illustrate Pathology? Following rheumatic fever, over next few years to decades, the typical funnel shaped mitral valve assumes a fish mouth appearance. During rheumatic fev
write the raspiration of different types of animals of different phylum
Legume - Development of seeds Outer epidermis of the ovary usually forms the exocarp of the leguminous pod. Next few cell layers constitute the mesocarp with thick-walled pare
Q. What are the Symptoms of Mitral stenosis? The cardinal symptom of mitral stenosis is dyspnoea on exertion. Typically it progresses over a period of years. As the severity in
Q. After menses what is the hormone that influences the maturation of the ovarian follicles? The maturation of the ovarian follicles after menses is stimulated by the action of
Define Water as a medium and solvent? Water is the medium of all cell fluids, including digestive juices, lymph, blood, urine, and perspiration. All the physiochemical reaction
Q. How is digestion performed in protozoans? Digestion in protozoans is intracellular digestion organic material degraded inside the cell and is internalized. Protozoans get
Q. Which respiratory adaptations or organs do aquatic and terrestrial arthropods respectively present? In crustaceans, typical aquatic beings, there are richly vascularized gil
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd