Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Glycogenesis: This is an anabolic process in which glucose is polymerized into glycogen by the sequence of reactions. Since glycogenesis occur in all body cells .but its main sites are liver and skeletal muscles. Liver and muscle cells remove excess glucose from blood and polymerize it into glycogen for storage .About 400 grams of storage glycogen is normally found in human body.
How is the striped pattern of the striated muscle cells formed? The functional units of the muscle fibers are the sarcomeres. Within the sarcomeres blocks of myosin and actin
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Define Nutritional Needs during Exercise? During Exercise: Addressing the nutritional needs during training is essential for optimal performance. The focus should be to:
Q. International Codes used for system of binomial nomenclature? In 1753 Linnaeus suggested a system of binomial nomenclature where each individual is denoted by two epithets,
Define Health Benefits of Other Dietary Factors with Antinutritional Effects? Despite the predominantly nutritional antagonistic effects of the factors described above, there i
How are the proteins important in metabolism of lens? Proteins Physical slate of protein is important for transparency of lens. Morner first time classified protein of l
PERIOD S OF CULTURAL EVOUITION AND MODERN MAN - Paleolithic period: Stone age. Age of tools of stones and bones, cave paintings. Mesolithi c period: Age of domesticati
DIFFERENCE S BETWEEN MAN & RABBIT - S.NO . 1. M A N Brain round RABBIT Elongated 2. Olfa
Q. What is structural formula of glycerol? To which organic function do these molecules belong? Glycerol is a linear chain of three carbons, the central carbon is bound to one
In tomatoes, two alleles of one locus determine the character difference of purple versus green stems (alleles are P and p with P being completely dominatn and coding for purple st
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd