Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Gene targeting: There is always a debate on gene integration in to the host animal.
It is random gene integration Vs gene targeting. Perhaps most significantly, pro-nuclear injection cannot be used to modify the animals' own genes. By contrast, target modifications to endogenous genes have been achieved earlier in mouse model and now in farm animals also. When introduced into the early embryo these cells contribute to the germline. They can also undergo homologous recombination with transfected foreign DNA so that precise, targeted changes can be introduced. The combination of these two properties means that gene targeting of the mouse germline is now routine, allowing for the deletion, replacement or modification of selected genes. Recombination on either side of the marker gene results in its precise insertion into the chromosome at the same time and delete some or the entire target gene. Precise targeting events are very rare (perhaps 1 in 106 cells) and, therefore special methods must be taken for identifying and selecting the correctly targeted cells.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Define some Usual Doubts of Children related to Food? Before embarking yourself to go through this unit, here is an activity for you to perform, Talk to 2-3 school' boys and gi
Why do substances react with each other? Chemical reactions occur due to the products of the reaction have less energy than the reactants (drive toward less energy). These reac
How have prokaryotic cells given origin to aerobic eukaryotic cells and to photosynthetic aerobic eukaryotic cells? As per to the most accepted hypothesis aerobic eukaryotic ce
List er i o si s The disease is caused by Listeria monocytogenes - Gram positive small non spore- forming bacilli seen in soil, silage, sewage and feces of animals and b
Q. How do sponges try to protect themselves against harm from the environment? Is that method rudimentary or efficient? Sponges can close their pores to avoid the entrance of w
CONNECTIVE TISSUE PROPER - 1 . AREOLAR TISSUE ( = Loose connective tissue) - Widely distributed connective tissue in the animal body. It consists of ground sub
how to test for water in a leaf?
How does classifying animals based on similarities and traits help future scientists
In glycoproteins, two main parts of oligosaccharide linkages exist: a) An O-linked oligosaccharides attached to the protein by O-glycosidic bonds, to the OH groups of serine or
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd