Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4
Megaloblastic Anaemia Megaloblastic anaemia refers to the abnormal development of red cells i.e. megaloblasts in the bone marrow. Etiology It is due to lack of f
Food Which can be Taken in Plenty and Food to be Avoided Lastly, in the context of changing the diet, we should know the foods to be avoided and the food to be taken in plenty
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
What is the pineal gland? The pineal gland, also called as pineal body or epiphysis, is situated centrally in the head. It secretes the hormone melatonin, a hormone formed at n
Membrane-bound organelles are absent in : 1. Saccharomyces 2. Streptococcus 3. Chlamydomonas 4. Plasmodium Streptococcus
A plant grown from one of Mendel's yellow pea is selfed. Three progeny peas from this are obtained and they are all green. Is the original plant homozygous or heterozygous, and wha
1. The genes for ruby eyes (rb), tan body (t) and cut wings (ct) are all found on the X-chromosome of Drosophila melanogaster. All of these are recessive traits. They map in the or
V apour Theory (i) It was proposed by a Greek philosopher Pythagoras in 500 B.C. (ii) Each organ of an animal body emitted some kind of vapour and that a ne
S y s te m i c Diseases Diseases of the gastrointestinal tract The diseases of gastrointestinal system are manifested by abnormality in prehension, mastication and s
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd