Gene mutatiorns, Biology

Assignment Help:

Gene or point mutations occur when the DNA sequence of a gene is altered and the new nucleotide sequence is passed on to the offspring. This occurs either due to addition or deletion or substitution of one or a few nucleoticles. Nucleotide substitutions can be either transitions or transversions. Transitions are replacements of a purine by another purine (A by G or vice versa) or a pyrimidiile by another pyrimidine (C by T or vice versa). Transversions are replacements of a purine by the pyrimidine or vice versa (G or A by C or T or vice versa). We will briefly explain the different types of gene mutations.

a) Substitutions : substitution of one base by another would result in an altered amino acid in a polypeptide chain. For instance triplet AAT in DNA (UUA in mRNA) would specify leucine. But if the first A is ieplaced by C, it will code for valine. Some of the codons are degenerate and substitutions may not alter the amino acid specified. For instance, in the triplet AAT if the first A is replaced by G the amino acid coded would still be leucine. Gene mutations which do not normally affect the active site of a protein will not alter its biological functions. But nucleotide substitutions that change a triplet coding lor an amino acid into a termination codon would produce adverse effects. Once again in AAT, if the second A is replaced hy T (An), the resulting rnRNA codon IJAA is a termination codon. When a termination codon is present in the middle of an mRNA molecule the subsequent codons are not translated and an incomplete polypeptide will be released from ribosomes.


Related Discussions:- Gene mutatiorns

Nutrition, nutrition in paramecium

nutrition in paramecium

Rigs pattern - types of nursing units, Rigs Pattern: The nursing unit ...

Rigs Pattern: The nursing unit has been divided into small cubicles for 1,2,4  and 6 beds.  The beds are arranged parallel to the  longitudinal wall.  The pattern was first bu

Mycotoxicosis, M yc ot o xi c osi s There are several types of m...

M yc ot o xi c osi s There are several types of mycotoxins (toxins produced by the fungi) e.g. aflatoxin, ochratoxin etc. Many species of fungi produce them but Aspergi

State the term in brief -asconoid sponge, State the term in brief -Asconoid...

State the term in brief -Asconoid sponge? Of the three different sponge architectures, it is the simplest. It comrpsies a central choanocyte lined spongocoel which opens to the

How is gas exchange done in flatworms, Q. How is gas exchange done in flatw...

Q. How is gas exchange done in flatworms? Platyhelminthes exchange gases exclusively by diffusion through their body surface. This is only possible because all cells are locali

Excretory organs, classification of excretory organs in helminthes, nermato...

classification of excretory organs in helminthes, nermatodes, annelids, molluscs, arthropods and echinodems

Main cytoplasmic structures present in animal cells, What are the main cyto...

What are the main cytoplasmic structures present in animal cells? Ans) The major cytoplasmic structures of the cell are the centrioles, the cytoskeleton, lysosomes, mitochondria

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Structures in a vertebrate with a four-chambered heart, Which of the follow...

Which of the following structures in a vertebrate with a four-chambered heart would have blood with the highest oxygen concentration? And why?

Describe about development of sexual maturity in children, Briefly Describe...

Briefly Describe about Development of Sexual Maturity in Children? Sexual maturity develops along with growth spurt in adolescence. In girls, growth stops on attaining menarche

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd