Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Functional Principles of Excretory Organs
Before studying about the excretory organs, it is important to learn about the basic concepts of osmolarity and membrane permeability. The presence of dissolved solute confers on a solution the property of osmotic pressure. Like other colligative properties, osmotic pressure or osmotic concentration f a solution depends on the P number of dissolved particles present per unit volume. While the chemical concentration of a solution is expressed in molarity (molesilitre), osmotic concentration of a solution is expressed in dsmolarity (osmoleditre). For ideal non-electrolytes (e.g., sucrose), a one molar solution is one osmolar.
An electrolyte solution, on the other hand, has a higher osmolarity than its molaiity. For example, Nacl in the solution dissociates into Na+ and Cl-. Thus, for everymolecule of NaCl, one gets two ionic particles in solution, one of Na+ and one of Cl-. Hence, one molar NACl solution is early two osmolar. In the same way, one molar CaCl2 solution is nearly three osmolar. An osrnole is defined as that amount of a solute which when dissolved in one litre of water has the same osmotic pressure as one mole of an ideal non-electrolyte in one litre of water. If two solutions (solution A and solution B) have the same osmotic concentration, they are said to be isopathic to each other. If solution A has a higher osmolarity than solution B, A is hyperosmotic to B or B is hypoosmotic to A.
Explain the Prevalence of Iodine Deficiency Disorders? We can determine the prevalence of IDD by conducting population surveys. Most of the population surveys are based on clin
Define Spiral cleavage in brief. Pattern of cell division in the developing embryo where products of the cell divisions shift by rotating either counterclockwise or clockwise s
Ribonucleases and deoxyribonucleases These enzymes are responsible for the degradation of dietary nucleic acids. Ribonucleases and deoxyribonucleases secreted by the
An alternative approach has been to identify areas with the highest number of endemics or species with a restricted geographical range. Assessments of this nature have been very of
is a cyclone density dependent or independent
Cellulose is a polysaccharide which is composed of the unbranched chains of glucose; the major structural carbohydrate of the plants, insoluble in water, and indigestible in the h
Malarial disease Malaria is a disease known since ancient times almost from 5th century B.C. The word malaria actually means bad air. It was believed that malaria is c
Define phases of the absorption of iron? The process of absorption is divided into three phases: i) Iron uptake by enterocytes (epithelial cell of the superficial layer of t
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Describe about Transposition of the Great Arteries ? Abnormal origin of the great artesies from the ventricular complex. Pulmonary Artery arises from the morphological left ven
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd