Function of lipids, Biology

Assignment Help:

FUNCTION OF LIPIDS

  1. Fats are storage products of both plants and animals.
  2. In plants, fats are commonly stored in spores and seeds while in animals they are stored in special cells called adipocytes.
  3. Fats are most highly concentrated source of energy, 9.2 kcal per gram.
  4. During metabolism and germination of oil seeds, fats are converted into carbohydrates.
  5. Edible Oils and Fats are obtained from many seeds and butter or cream extracted from milk.
  6. Unsaturated oils present in spores and seeds protect the embryo from ultraviolet radiation during their dispersal through air.
  7. Adipose or fatty tissue occurs below the skin to provide insulation from low temperature.
  8. Subcutaneous fat of Whale is quite thick and is called blubber.
  9. Fragrance of essential oils, butte and other fats is mostly due to terpenses (Menthol, Camphar).
  10. Desert animals employ fat for respiration in order to liberate more metabolic water as compared to carbohydrate, e.g., Kangaroo Rat, Camel (during period of non-availability of water).
  11. Oil or sebum from sebaceous glands keeps the hair lubricated.
  12. Oil from preen gland of birds is similarly used to lubricate the feather.
  13. Soaps are formed from fats through the process of saponification.
  14. Cuticle is made of cutin and wax. It reduces epidermal transpiration.
  15. Cerumen or ear wax lubricates ear drum.
  16. Wax coating prevents clogging of stomata and wetting of upper surface of flowting leaves.
  17. Lanolin provides water proof coating to fur of animals.
  18. Bees wax is used in polishes and creams.
  19. Paraffin wax is used in preparing candles.
  20. Spermaceti (from Sperm Whale) is lubricant for fine machinery.
  21. Jojoba wax is used similarly. It is also ingredient of cosmetic creams.
  22. Myelin Sheath is found around medullated nerve fibres. It prevents loss of energy, impulse dilution and interference from other fibres.
  23. Phospholipids of blood platelets are connected with thromboplastin activity in early stages of blood clotting.
  24. Blood platelets also contain prostaguladin thromboxane for vasoconstriction.
  25. Polyunsaturates are essential for preventing atherosclerosis.

2270_lipid test.png

Note :- Person born with lipid abnormality disorder is lepdosis.


Related Discussions:- Function of lipids

Effects of cardiogenic pulmonary edema, Effects of Cardiogenic Pulmonary Ed...

Effects of Cardiogenic Pulmonary Edema Interference with oxygen transfer in the lungs Depression arterial oxygen tension Sense of suffocation and oppression in the

Management of respiratory failure, Management Goals Improve ...

Management Goals Improve oxygenations and ventilation to restore the person/s Pa 2 O 2 and PaCO 2 , to their previous levels.  Understand the underlying cause.

What is a population, What is a population? The population is a set of ...

What is a population? The population is a set of individuals of the same species found in a given place in a given time.

Explain the completed test - most probable number test, Explain the Complet...

Explain the Completed Test - Most Probable Number Test? Coliform colonies on EMB or Endo agar are further examined by completed test by inoculating lactose broth and nutrient a

Explain continuous murmurs and their characterstic, Explain Continuous Murm...

Explain Continuous Murmurs and their characterstic in details? These murmurs are continuous throughout systole and diastole. It is due to continuous blood flow in the same dire

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Genotype for each individual, The allele that causes albinism (p) is recess...

The allele that causes albinism (p) is recessive to the allele for normal pigmentation (P). A normal woman whose father is an albino marries an albino man whose parents are both no

Microtubules, MICROTUBULES Discovered by De Robertis and Franchi ...

MICROTUBULES Discovered by De Robertis and Franchi . Term given by Slautterback . These are hollow structures, consists of tubulin protein. Each protein diamer

Structures shared by every chordate, Q What are the three structures shared...

Q What are the three structures shared by every chordate that characterize the group? All beings of the phylum Chordata have branchial clefts in the pharynx in some species pre

Explain somatic cell, For a somatic cell with 2n = 4, which of the followin...

For a somatic cell with 2n = 4, which of the following is true? (Note: G1- growth phase 1, G2 - growth phase 2, M - metaphase, P - prophase and T - telophase) a.  (Number of

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd