Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Fuel Requirements - Deforestation
The increasing demand for fuel wood is one of the major factors leading to the degradation of the forest ecosystem. Fuel wood is of such major importance as a forest produce that about one-half of all the wood cut in the world is used for lighting, cooking or heating purposes. Even today more than one third of humanity still relies on wood for fuel. In the recent years, the oil crisis and the sharp increase in the prices of oil have further escalated the demand for wood as fuel.
The fuel wood consumption has gone up from 86.3 million tonnes in 1953 to about 135 million tonnes in 1980, and it is believed that by the year 2000 A.D., the demand for firewood would be in the range of 300 to 330 million tonnes. The increasing demand for firewood with every passing year means greater pressures on the forests, which also means increased intensity of deforestation.
List the two primary targets to assess the good sugar control 1) There are two primary targets to assess the effectiveness of the management plan on glycemic (sugar) controls.
Explain Properties related to protein-protein interactions? Properties related to protein-protein interactions include dough formation, one of the important functional properti
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Tasks of Orientation Phase: Establishing contact with the patient Developing the pactlcontract Talking to the patient Establishing Contact with the Patient
Of which type of tissue is the heart made? How is this tissue oxygenated and nutrified? The heart is made of striated cardiac muscle tissue. The heart muscle is known as the my
Individual components of biodiversity provide an unbeliev able wide range of products that are used to enhance the lives of people in all countries of the world. It is the diversit
mitochondria?
How are triglycerides made? Triglycerides, fats or oils, are made of three molecules of fatty acids bound to single molecule of glycerol. Hydroxyls of each one of the three fat
Define species according to the biological species concept. What two problems often make this definition impractical?
Which is the normal sign of the electric charge among the two sides of the neuron plasma membrane? What is the potential difference (voltage) generated among these two sides? What
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd