Fuel requirements - deforestation, Biology

Assignment Help:

Fuel Requirements - Deforestation

The increasing demand for fuel wood is one of the major factors leading to the degradation of the forest ecosystem. Fuel wood is of such major importance as a forest produce that about one-half of all the wood cut in the world is used for lighting, cooking or heating purposes. Even today more than one third of humanity still relies on wood for fuel. In the recent years, the oil crisis and the sharp increase in the prices of oil have further escalated the demand for wood as fuel.

The fuel wood consumption has gone up from 86.3 million tonnes in 1953 to about 135 million tonnes in 1980, and it is believed that by the year 2000 A.D., the demand for firewood would be in the range of 300 to 330 million tonnes. The increasing demand for firewood with every passing year means greater pressures on the forests, which also means increased intensity of deforestation.


Related Discussions:- Fuel requirements - deforestation

List the two primary targets to assess good sugar control, List the two pri...

List the two primary targets to assess the good sugar control 1) There are two primary targets to assess the effectiveness of the management plan on glycemic (sugar) controls.

Explain properties related to protein-protein interactions, Explain Propert...

Explain Properties related to protein-protein interactions? Properties related to protein-protein interactions include dough formation, one of the important functional properti

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Tasks of orientation phase - phases of nurse, Tasks of  Orientation Phase: ...

Tasks of  Orientation Phase: Establishing contact with the patient  Developing  the pactlcontract  Talking to the patient  Establishing Contact with the Patient

Of which type of tissue is the heart made, Of which type of tissue is the h...

Of which type of tissue is the heart made? How is this tissue oxygenated and nutrified? The heart is made of striated cardiac muscle tissue. The heart muscle is known as the my

Biodiversity as products, Individual components of biodiversity provide an ...

Individual components of biodiversity provide an unbeliev able wide range of products that are used to enhance the lives of people in all countries of the world. It is the diversit

How are triglycerides made, How are triglycerides made? Triglycerides, ...

How are triglycerides made? Triglycerides, fats or oils, are made of three molecules of fatty acids bound to single molecule of glycerol. Hydroxyls of each one of the three fat

Define species of biological species concept, Define species according to t...

Define species according to the biological species concept. What two problems often make this definition impractical?

Which is the normal sign of the electric charge, Which is the normal sign o...

Which is the normal sign of the electric charge among the two sides of the neuron plasma membrane? What is the potential difference (voltage) generated among these two sides? What

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd