Fowl pox, Biology

Assignment Help:

Fowl pox

Fowl pox is a contagious disease of birds, caused by a member of family Poxviridae, characterized by wart-like nodules on the skin and diphtheritic necrotic membranes lining the upper digestive and respiratory system. Mortality is not usually significant unless the respiratory involvement is marked. The disease occurs in all age groups of birds and affects weight gain as well as egg production. The virus is highly resistant in dried scabs and under certain conditions may survive for months on contaminated premises. Pigeon pox virus and canary pox virus are the other two different but related strains that present similar clinical picture.

Fowl pox can be transmitted by direct or indirect contact. The disease may be mechanically transmitted by mosquitoes that may harbor infective virus for a month or more after feeding on affected birds. After the infection is introduced, it spreads within the flock by mosquitoes as well as direct and indirect contact. Recovered birds do not remain carriers.

Symptoms and lesions: Affected young birds are retarded in growth. Drop in egg production in laying birds is a constant finding. Birds with oral or respiratory involvement have difficulty in eating and breathing. The disease manifests itself in one or two ways, cutaneous pox (dry form) or diphtheritic pox (wet form). Dry pox starts as small whitish foci that develop into papules, pustules, pocks and scabs. The scabs eventually are sloughed off with healing if not complicated with secondary infection. Lesions are most commonly seen on the combs, wattles, feet etc. Wet pox is associated with the upper digestive and respiratory tract, particularly the mouth, esophagus, larynx and trachea. The lesions are diphtheritic in character and involve the mucous membranes revealing an ulcerated or eroded area.

Diagnosis: The clinical picture and lesions are adequately confirmatory. In some cases, laboratory diagnosis by virus isolation in chicken embryos or transmission studies is necessary.

Prevention and control: Disease can be prevented by biosecurity measures coupled with vaccination. In India, quality vaccine for fowl pox is available and used by wing web applicator that provides satisfactory immunity.


Related Discussions:- Fowl pox

Digestive system in planarias, Q. How are nutrients distributed through the...

Q. How are nutrients distributed through the digestive system in planarias? Planarias have single opening digestive system incomplete with ramifications that transport nutrient

What is the typical shape of poriferans, What is the typical shape of porif...

What is the typical shape of poriferans? Sponges have bodies in the type of tubular vases or globes open in the upper extremity. They have an internal central cavity and porous

Explain ritonavir, Ritonavir (RTV, Norvir)  Ritonavir is well absorbed ...

Ritonavir (RTV, Norvir)  Ritonavir is well absorbed  from the gastrointestinal tract and at full doses potently inhibits HIV, but due to poor tolerability it is now used mainly

Explain types of dietary adaptations for trerapieutic needs, Types of dieta...

Types of dietary adaptations for trerapieutic needs Normal nutrition is the foundation upon which therapeutic modifications are based. We  have already discussed  in  previous

Explain about the colorimeter, Explain about the Colorimeter? Colorimet...

Explain about the Colorimeter? Colorimeter is an instrument for measuring the colour or colour intensity of a solution. It is an instrument that measures the concentration of a

Explain some weight loss during breastfeeding, Explain some Weight Loss dur...

Explain some Weight Loss during breastfeeding? Some women may want to return quickly to their pre-pregnancy weight. It is important to remember that some women will lose more,

Explain what is patent ductus arteriosus in details, Explain what is Patent...

Explain what is Patent Ductus Arteriosus in details? Figure : Anatomical location of PDA Patent Ductus Arteriosus (PDA) may be an isolated defect or may co-exist with

Describe the developmental periods of coronary artery diseas, Describe the ...

Describe the Developmental Periods of coronary artery diseases? The development of coronary artery disease like many other diseases can be divided into the following periods:

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd