Fowl cholera, Biology

Assignment Help:

Fowl cholera

Fowl cholera, a highly contagious disease of poultry caused by Pasteurella multocida, was one of the first infectious diseases to be recognized by Louis Pasteur in 1880. The infection can range from acute septicemia to chronic and localized infection and in acute cases, very high morbidity and mortality that may reach up to

100%. Predisposing factors include high density and concurrent infections such as respiratory viruses. The disease is transmitted via oral or nasal route. The bacterium is susceptible to environmental factors and disinfectants, but may persist for prolonged periods in soil. Reservoirs of infection may be present in other species such as rodents, cats and possibly pigs.

P. multocida is non motile Gram-negative coccobacillus. Capsule is seen in freshly isolated culture. It can grow both aerobically and anaerobically. The bipolar nature of the bacteria is the characteristic feature on staining with methylene blue or Leishman' stain and is helpful in easy identification.

Symptoms and lesions: Ruffled feathers, loss of appetite, coughing, nasal, ocular and oral discharge, swollen and cyanotic wattles and face are the common signs. In some cases, diarrhoea, swollen joints, lameness may also be seen.  Sometimes PM changes are not seen or limited to hemorrhages at few sites but generally focal hepatitis, consolidation of lungs, suppurative pneumonia (especially in turkeys), cellulitis of face and wattles, purulent arthritis or enteritis are noted.

Diagnosis: Typical bipolar stained, dumbbell-shaped organisms are seen in blood smears/ impression smears. Isolation can be easily done by aerobic culture on blood agar and further confirmed with biochemical tests.

Prevention and control: Biosecurity, rodent control, hygiene and healthy diet are enough to prevent the disease. This is mostly opportunistic infection; special care is to be taken during stress or other respiratory viral infections.


Related Discussions:- Fowl cholera

Describe the intensity of s2 in second heart, Describe the Intensity of S 2...

Describe the Intensity of S 2 in second heart ? Loud A 2 occurs in patients with hypertension, when aorta is closer to anterior chest wall owing to root dilatation or TGA or

File & chemical removal of gutta percha-endodontics, File  & chemical remov...

File  & chemical removal of gutta percha: -    K-type file & chloroform is the best choice in small and curved canals. -    The pulp chamber floated with chloroform, then k-typ

Which are the germ layers present in cnidarians, Q. Which are the germ laye...

Q. Which are the germ layers present in cnidarians? Which tissues of the animal do they originate? These beings present endoderm and ectoderm, two germ layers. Animals only wit

Explain the bases, The bases in DNA have carbon-nitrogen ring structures; d...

The bases in DNA have carbon-nitrogen ring structures; due to the nitrogen atoms they are known as nitrogenous bases. There are two parts of ring structure. Adenine and guanine are

Explain armamentarium, Armamentarium 1. Denture duplicator or a modifie...

Armamentarium 1. Denture duplicator or a modified plastic soapdish. (A plastic large soapdish with a base and cover can be adapted by drilling 2 mm holes interspersed and cover

Animals - rapidly flowing waters, Animals - Rapidly Flowing Waters In ...

Animals - Rapidly Flowing Waters In the exposed rock surface habitats only those organisms are found which have efficient mechanisms for staying in one place. In fact despite

Determine about benefits of jogging, Determine about benefits of Jogging ...

Determine about benefits of Jogging Jogging gives a sense of wellness to a diabetic patient. The frequency of jogging should be at least 3 days in week with a distance of 2 km

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What type of building block is atp, Please show a diagram of the ATP molecu...

Please show a diagram of the ATP molecule and label the major parts ot this molecule. Also, what kind of building block is ATP?

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd