Foot-rot, Biology

Assignment Help:

Foot-rot

Foot-rot is a term applied to the condition of feet of cattle, sheep, goats and sometimes pigs. It is characterized by inflammation, necrosis and ulceration of underlying tissues of foot. The disease is widespread in many tropical countries with highest incidence in sheep. The disease is related to climatic conditions. High temperature and humidity favour the disease. Foot rot in cattle and sheep is caused by Fusobacterium necrophorum complicated by Dichelobacter nodosus, especially in sheep.


Transmission:
Animals in chronic state transmit infection directly to healthy animals. The sheep can remain as carrier for 3-4 years. Conditions of wetness and warmth favour the persistence of bacteria in the pasture. Infected cattle may often serve as the source of infection.


Symptoms:
The earliest sign of foot-rot is swelling and moistness of skin of inter  digital cleft. This is accompanied by lameness which increases as necrosis under-runs the horn in cleft. The animal may carry the leg or walk on its knees. In severe cases, there may be anorexia and fever. Symptom less carriers may be present for a period up to 3 years.A history of lameness in a flock is suggestive of foot-rot. This can be confirmed from clinical examination of typical lesions and microscopical examination of smears from the lesions after staining with Gram’s strain or Loeffler’s methylene blue. The organisms appear pink coloured short rods.


Diagnosis: It is difficult to diagnose foot-rot. Identification of Gram-negative bacilli is sufficient to diagnose the disease.


Treatment and control: wet pastures should be properly drained. The affected hooves of the diseased animals should be trimmed. The exposed infected tissue should be treated with 10% formalin or with chloramphenicol or tetracycline. The parenteral treatment with a mixture of penicillin and streptomycin is of value.


Related Discussions:- Foot-rot

What do you mean by blackcaps, Q. What do you mean by Blackcaps? Blackc...

Q. What do you mean by Blackcaps? Blackcaps are small songbirds found throughout Europe. A large population of blackcaps inhabits the forests of Germany. These blackcaps have t

Define causes of iron deficiency anaemia, Define Causes of iron Deficiency ...

Define Causes of iron Deficiency Anaemia? Anaemia is a condition in which the blood cannot carry enough oxygen. This may be because there are fewer red blood cells than normal,

Measures to control of noise pollution, 1.      Noise producing industries,...

1.      Noise producing industries, railway stations, and aerodromes should be located away from the residential areas. 2.      Check on the traffic in the residential colonies.

What is osmotic pressure, Q What is osmotic pressure? Osmotic pressure ...

Q What is osmotic pressure? Osmotic pressure is the pressure produced in an aqueous solution by a region of lower solute concentration upon a region of higher solute concentrat

Explain fosamprenavir calcium, Explain Fosamprenavir calcium It is a pr...

Explain Fosamprenavir calcium It is a prodrug of amprenavir, was recently approved by the FDA for use in HAART. In patients who have not lastly been treated with a protease inh

Determine the synaptic process, Since neurotransmitters are not consumed in...

Since neurotransmitters are not consumed in the synaptic process, what are the mechanisms to decrease their concentrations in the synaptic cleft after they have been used? As t

What is predatism, What is predatism? Predatism is the ecological inte...

What is predatism? Predatism is the ecological interaction in which one individual mutilates or kills another to get food. Predatism is an inharmonious (negative) ecological i

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd