Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Floral Initiation
Activation is generally most marked in the central zone of the meristems. Most of the responses following inductive treatment have been recorded in different meristem components. For example in the peripheral zone in Sinapis alba, central corpus in Xanthium and sunflower, central tunica in tobacco, leaf primordia in some cases-are some of the zones where greater activity in terms of cell division and differentiation are noted in the shoot apex after exposure to inductive stimuli. Rise in RNA levels, increase in synthesis of new proteins, increase in general in translation, increase in ATP levels are some of the major molecular events that follow floral induction.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
What is covalent bonds? Covalent Bonds : Covalent bonds form when atoms share electrons in order to become more stable. Instead of gaining electrons or losing electrons enti
Describe the Methods of Assessment The four general principles outlined above, that is, adaptation, brain and behaviour, context, and development serve as the foundation for th
Write an essay on cytological approach in taxonomy.
Bacterial artificial chromosome (BAC) is a chromosome-like structure, made by genetic engineering. BAC is a cloning vector able to carrying between 100 and 300 kilo bases of targe
DEALCOHOLISM - Treatment of alcoholism or withdrawal symptoms of alcohol is known as dealcoholism. Recovery from alcohol dependence is greatly aided by sociobehavioural c
Q. Define the Risk reduction in cardiovascular disease? Ans. Weight loss by caloric restriction diets has been shown to decrease plasma CRP levels. Additional data indicat
Explain Nutrient Requirement and Dietary Management? You must have understood by the discussion above that by the end of the flow phase, the patient usually is well hydrated an
Ranikhet disease Ranikhet disease, also known in the west as Newcastle disease, is a contagious and highly fatal disease of fowls caused by a virus of the genus Rubulavirus in
Phylum Sarcomastigophora Locomotory organelles - flagella, pseudopodia or both types, usually with one type of nucleus; typically no spore formation, sexual reproduction thro
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd