FISHERIES, Biology

Assignment Help:
skeletal system of fish .exoskeleton and endoskeleton

Related Discussions:- FISHERIES

Explain biological function, Q. Concerning their biological function what i...

Q. Concerning their biological function what is the difference between meiosis and mitosis? The main biological function of mitosis is cellular multiplication a fundamental pro

Functions of skeleton, FUNCTIONS OF SKELETON - 1.      Support. 2.  ...

FUNCTIONS OF SKELETON - 1.      Support. 2.      To give shape to the body. 3.      Protection of different organs. 4.       Site for muscle attachment. 5.       He

What is glycosylated haemoglsbin, Q. What is Glycosylated Haemoglsbin? ...

Q. What is Glycosylated Haemoglsbin? Glycosylated haemoglobin values give important diagnostic inferences regarding the recent past of a diabetic i.e. how well he/she managed t

Find the equilibrium molality of solute species, Find the equilibrium molal...

Find the equilibrium molality of solute species? Consider a hypothetical system in which two aqueous solutions are separated by a semipermeable membrane. Solution α is prepared

Explain phylum cyanobacteria, Phylum Cyanobacteria Cyanobacteria  are p...

Phylum Cyanobacteria Cyanobacteria  are prokaryotes,  but  they are not  like bacteria  in  the usual  sense of  the word.  The cyanobacteria  lack chloroplasts,  and  their  l

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write the meaning of hyperglycemia, Q. Write the meaning of Hyperglycemia? ...

Q. Write the meaning of Hyperglycemia? Hyperglycemia is a Greek term: hyper -meaning excessive; glyc - meaning sweet; and emia- means "of the blood". It is a condition in whic

Viruses, what is the basic structure of a virus?

what is the basic structure of a virus?

What are prions? define concerns of food safety, Normal 0 false...

Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd