Finding the problem by communication process, Biology

Assignment Help:

Q. Finding the Problem by communication process?

- Open up the patient with general talk.

- Initiate topic easy to talk.

- Ask simple questions easily understood.

- Ask one question at a time.

- Later take detailed history.

- Do not interfere in-between.

- Do not suppress feelings, ideas.

- Make patient free to talk and express.

- Explore the patient's beliefs, values and respect them.

- Be an active listener.

- Repeat what client has said.

- Help the client to focus on the problem.

- Recogni-e the related problems.

- Make short notes.

- Make a summary of the talk and identify the problem.

- Assess the impact of the problem on the patient's life and treatment.

- Explore the resources, coping skills and support available to the client.


Related Discussions:- Finding the problem by communication process

What is technetium 99m sestamibi scan, Q. What is Technetium 99M Sestamibi ...

Q. What is Technetium 99M Sestamibi Scan? This study is another form of studying perfusion of the heart. This radioactive study is similar to that of thallium 201. With a combi

Explain about the civil law, Explain about the civil law. Civil law: ...

Explain about the civil law. Civil law: This region of the law explains the rights and obligations of persons. This resolves any disputes occurring between persons over t

Define future challenges for dynamical network, Define Future challenges fo...

Define Future challenges for dynamical network? Graph theory is an old field of mathematics where biological applications are driving new advances. Mathematicians are supplemen

Are birds rare in polar regions, How different are reptiles and birds conce...

How different are reptiles and birds concerning the maintenance of body temperature? Are birds rare in polar regions? Reptiles are heterothermic, i.e., they do not control thei

State long-term benefits of exercise, State four long-term benefits of exer...

State four long-term benefits of exercise. The long-term advantages of exercise are: a) Enhance in size of the muscles used, b) Decrease of heart rate and c)  Enhance

How do sponges try to protect themselves, Q. How do sponges try to protect ...

Q. How do sponges try to protect themselves against harm from the environment? Is that method rudimentary or efficient? Sponges can close their pores to avoid the entrance of w

Skin puncture - specimen collection, Skin puncture: skin puncture is...

Skin puncture: skin puncture is usually done when small volume of blood is needed (e.g., blood glucose test) to avoid unnecessary venipuncture. However, skin puncture in

What is the essential condition for protein to be identical, What is the es...

What is the essential condition for a protein to be identical to another protein? For a protein to be identical to another protein it is essential for the sequence of amino aci

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

.general methods for studying microbial physiology, what are the general me...

what are the general methods for studying microbial physiology

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd