Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
FilariasisFilariasis is a chronic infection caused by filarid worms. Around 10 species of Filaridae family are parasitic to man. Adult worms live in the tissues or body cavities of the vertebrate hosts. The female filarid worms produce embryonated eggs, which during oviposition contain embryos that become delicate thread like organisms called microfilariae. The microfilarae are circulated in the peripheral blood or other cutaneous tissue from where they are transmitted by blood sucking arthropods. The disease is widely prevalent in Asian countries including India.The lymph glands of patients get enlarged. Adenolymphangitis often accompanied by swelling of a limb, recurrent fever, eosinophilia and pulmonitis. Sterile abscess appears at varying intervals. Diagnosis is made on the basis of clinical symptoms and demonstration of microfilariae in thick blood smears. The disease can be prevented by reducing the vector population and environmental sanitation.
why their is different amount of yolk is present in eggs.
Food Applications of alginate One of the most unusual properties of the alginates has been the ability of soluble alginate salts to produce attractive, edible gels or jellies.
wt is an air bladder and its function wt is catadromous and anadromus migration
Staphylococcal food poisoning results from consumption of food containing enterotoxin produced by enterotoxigenic strains of Staphylococcus aureus. It is caused by ingestion of imp
AMITOSIS This is direct cell division in which the genetic material is not duplicated and hence its distribution to the daughter cells is not precisely half and half,
Define Calcium requirements of infants? The calcium requirements of young infants are computed from the calcium content of breast milk and volume of breast milk intake. Up to 6
Describe frequently respiratory infactions to recoganize congenital heart disease ? Frequent Respiratory Infections: Respiratory infections that are frequent, severe and diffic
Q. What is signifying when it is said that beings of the phylum Annelida are vascular beings? From which other phyla of the animal kingdom does this feature differentiate them?
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Freezing Point - Properties of Solutions The freezing point of a material is the temperature at which it changes from a liquid to a solid. A liquid freezes when its vapour pre
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd