Filariasis, Biology

Assignment Help:

Filariasis
Filariasis is a chronic infection caused by filarid worms. Around 10 species of Filaridae family are parasitic to man. Adult worms live in the tissues or body cavities of the vertebrate hosts. The female filarid worms produce embryonated eggs, which during oviposition contain embryos that become delicate thread like organisms called microfilariae. The microfilarae are circulated in the peripheral blood or other cutaneous tissue from where they are transmitted by blood sucking arthropods. The disease is widely prevalent in Asian countries including India.
The lymph glands of patients get enlarged. Adenolymphangitis often accompanied by swelling of a limb, recurrent fever, eosinophilia and pulmonitis. Sterile abscess appears at varying intervals. Diagnosis is made on the basis of clinical symptoms and demonstration of microfilariae in thick blood smears. The disease can be prevented by reducing the vector population and environmental sanitation.


Related Discussions:- Filariasis

Egg type, why their is different amount of yolk is present in eggs.

why their is different amount of yolk is present in eggs.

Describe food applications of alginate, Food Applications of alginate O...

Food Applications of alginate One of the most unusual properties of the alginates has been the ability of soluble alginate salts to produce attractive, edible gels or jellies.

.phylum pisces, wt is an air bladder and its function wt is catadromous and...

wt is an air bladder and its function wt is catadromous and anadromus migration

Staphylococcal food poisoning, Staphylococcal food poisoning results from c...

Staphylococcal food poisoning results from consumption of food containing enterotoxin produced by enterotoxigenic strains of Staphylococcus aureus. It is caused by ingestion of imp

Amitosis, AMITOSIS This  is  direct  cell division  in which  the genet...

AMITOSIS This  is  direct  cell division  in which  the genetic material is not duplicated and  hence its distribution  to the daughter cells  is not  precisely half  and half,

Define calcium requirements of infants, Define Calcium requirements of infa...

Define Calcium requirements of infants? The calcium requirements of young infants are computed from the calcium content of breast milk and volume of breast milk intake. Up to 6

Describe frequently respiratory infactions heart disease, Describe frequent...

Describe frequently respiratory infactions to recoganize congenital heart disease ? Frequent Respiratory Infections: Respiratory infections that are frequent, severe and diffic

Phylum annelida are vascular beings, Q. What is signifying when it is said ...

Q. What is signifying when it is said that beings of the phylum Annelida are vascular beings? From which other phyla of the animal kingdom does this feature differentiate them?

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain about freezing point - properties of solutions, Freezing Point - Pr...

Freezing Point - Properties of Solutions The freezing point of a material is the temperature at which it changes from a liquid to a solid. A liquid freezes when its vapour pre

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd