Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Summer Stratification - Thermal stratification Thermal stratification is fairly pronounced during the summer seasons in most lakes of the temperate (cold) regions but is rare
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
What is Cyanobacteria or Blue-green bacteria? Blue-green bacteria, or cyanobacteria, used to be classified as blue-green algae within the Plant Kingdom, primarily because they
BRAI N (ENCEPHELON) Shape - Oval Positio n - Situated in cranial cavity of skull. Medulla oblongeta comes out of foramen magnum in the form of spinal cord. Colou
In a school laboratory, what is usually regarded as evidence that photosynthetis has occurred in a plant
Define the effect of Vitamins (A, D, K and B-Complex) on athletes? Vitamins A, D and K have been found to have no ergogenic effects. Ingesting large doses of these vitamins hav
Can you use a regular syringe instead of a gas syringe in a lab
Explain about the Prebiotics? Ingredients/compounds that have a beneficial effect on microflora in the large intestine of the host e.g. fibre, fructo oligosaccharides, lactulos
Define Recommended Intake of Fibre? 1. A minimum of fibre intake of 20 g/day is recommended by the American Dietetic Association (ADA), the National Cancer Institute, US and th
Pulmonary valve is surface marked at the sternal end of the left 3rd costal cartilage. Aortic valve is surface marked at the sternal margin of the left 3rd intercostal space. Mitra
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd