Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
In earthworms, when the ovaries mature, the clitellum secretes a viscous substance in the form of a girdle. This girdle hardens in to a cocoon around the clitellum. The ova are discharged into cocoon. When this cocoon moves over the spermathecae openings, the sperms which are already collected from another worm and stored in the spermathecae are discharged into the cocoon. The cocoon finally, comes out of the body and fertilization takes place in the cocoon. As it is taking place outside the body, it is called as "external fertilization".
Most proteins made by ribosomes on the RER (rough endoplasmic reticulum) are glycoproteins, which is they hold short chains of carbohydrates (oligosaccharides) covalently related t
Rheumatic heart disease was the predisposing cardiac lesion for IE in 20 to 25 per cent. In patients with rheumatic heart disease, endocarditis occurs most frequently on the mitral
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Briefly Explain about the Chromium? As you will go through this section, you will realize that compared to other minerals, the essentiality of chromium was recognized very late
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
1) The presence of epicardial coronary artery stenosis caused by artherosclerotic plaques is by far the most frequent angiographic finding in any cardiac ischaemic syndrome. 2)
Q. What is Goitrogens anti-thyroid substance? Ans. Goitrogenslanti-thyroid substances present in certain plant foods have been found to interfere with the uptake of iodine
Clotting Disorder - Haemophilia Haemophilia is a congenital blood clotting disorder caused by the genetic lack/ deficiency of coagulation factor VIII or antihaemophiliac
Determine the term - Angiomas Angiomas are congenital collections of abnormal vessels that divert the normal flow of blood. These capillaries, venous, or arteriovenous (A-V) ma
What is neiosis
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd