Fats and lipids, Biology

Assignment Help:

 

  • Composed of C, H and O (fewer polar OH bonds than carbohydrates)
  • Can be used at energy storage, components of cell membranes, chemical signals & thermal insulation
    • Are a more efficient energy source then carbohydrates
  • 4 families à fats (triglycerides), phospholipids, steroids & waxes

Triglycerides

                                                                                                        2331_fats and lipids.png

Triglycerides - An ester of 3 fatty acids + a glycerol molecule
Glycerol - a 3 carbon alcohol with 3 hydroxyl groups
Fatty Acid - a long-chain carboxylic acid

  • Fatty acids can be saturated of unsaturated and usually even numbered (16 or 18)
    • Saturated -> In animals                                                                                                                                                 Long straight chains and can rotate freely on the glycerol backbone

                      Can be packed tightly together à solids

               o  Unsaturated ->in plants

                        Cannot rotate freely and have kinks in their chain (due to 'cis' & 'trans' shapes from the double bond)

                        Cannot be packed closer together à liquids

Phospholipids

  • Glycerol + 2 fatty acids
  • Has hydrophobic tails and a hydrophilic head

Steroids

  • Hydrophobic molecules with 4 fused hydrocarbon rings (e.g. cholesterol, vitamin D, bile salts)

Waxes

  • Lipids containing long chain fatty acids linked to alcohols or carbon rings
  • Hydrophobic

 


Related Discussions:- Fats and lipids

Shifting attention by dopamine, Q. Shifting attention by Dopamine? Dopa...

Q. Shifting attention by Dopamine? Dopamine: Dopamine plays a pivotal role in aspects of shifting attention. Administration of D1/D2 receptor antagonist haloperidol impairs the

Is a viral infection treated with drug, Q. Is a viral infection treated wit...

Q. Is a viral infection treated with the same kind of drug that treats bacterial infections? The Antibacterial drugs, potent against a great variety of bacteria, are not effect

Gregor johann mendel, GREGOR JOHANN MENDEL 1.         Mendel was born o...

GREGOR JOHANN MENDEL 1.         Mendel was born on 22 July 1822 at Heizendorf in Austria at Selesia village. 2.         Mendel was worked in Augustion Monastry as monk at Br

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Are the xylem and the phloem made of living cells, Are the xylem and the ph...

Are the xylem and the phloem made of living cells? The cells that constitute the xylem ducts are dead cells killed by lignin deposition. The cells of the phloem are living

Define casein - tests for presence of exoenzymatic activity, Define Casein ...

Define Casein - Tests for Presence of Exoenzymatic Activity? Casein is a major milk protein composed of various amino acids linked through peptide bonds. Extra-cellular enzyme

Management of diet for diabetes, Q. Management of Diet for diabetes? Di...

Q. Management of Diet for diabetes? Diet plays a very important role in management of diabetes as it exerts a direct influence on the blood glucose levels. It is one of the vit

Fluorosis, Fl u o r osi s Continual ingestion of small amount of f...

Fl u o r osi s Continual ingestion of small amount of fluoride through feed or water leads to fluorosis in animals. The toxic effects are based on amount of fluorine inges

Botany, economic importance of viruses and bacteria ?

economic importance of viruses and bacteria ?

Theory of embryology - germ plasm theory, GER M PLASM THEORY - It w...

GER M PLASM THEORY - It was proposed by Weismann. According to it, two types of cells are formed during embryonic development viz - Germ cell & Somatic cell. The germ ce

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd