Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Triglycerides - An ester of 3 fatty acids + a glycerol molecule Glycerol - a 3 carbon alcohol with 3 hydroxyl groups Fatty Acid - a long-chain carboxylic acid
Can be packed tightly together à solids
o Unsaturated ->in plants
Cannot rotate freely and have kinks in their chain (due to 'cis' & 'trans' shapes from the double bond)
Cannot be packed closer together à liquids
Q. Shifting attention by Dopamine? Dopamine: Dopamine plays a pivotal role in aspects of shifting attention. Administration of D1/D2 receptor antagonist haloperidol impairs the
Q. Is a viral infection treated with the same kind of drug that treats bacterial infections? The Antibacterial drugs, potent against a great variety of bacteria, are not effect
GREGOR JOHANN MENDEL 1. Mendel was born on 22 July 1822 at Heizendorf in Austria at Selesia village. 2. Mendel was worked in Augustion Monastry as monk at Br
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Are the xylem and the phloem made of living cells? The cells that constitute the xylem ducts are dead cells killed by lignin deposition. The cells of the phloem are living
Define Casein - Tests for Presence of Exoenzymatic Activity? Casein is a major milk protein composed of various amino acids linked through peptide bonds. Extra-cellular enzyme
Q. Management of Diet for diabetes? Diet plays a very important role in management of diabetes as it exerts a direct influence on the blood glucose levels. It is one of the vit
Fl u o r osi s Continual ingestion of small amount of fluoride through feed or water leads to fluorosis in animals. The toxic effects are based on amount of fluorine inges
economic importance of viruses and bacteria ?
GER M PLASM THEORY - It was proposed by Weismann. According to it, two types of cells are formed during embryonic development viz - Germ cell & Somatic cell. The germ ce
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd