Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
State the changes in society which could contribute to a falling death rate.
The changes in society which could contribute to a falling death rate are:
(i) improvements in clean water, sewage disposal and sanitation,
(ii) Better health care, containing immunisation programmes,
(iii) Improved standards of nutrition and housing,
(iv) Better education, leading to the changes listed above,
(v) Greater wealth, leading to the changes listed above.
Psychological Problems Failure to fulfill the patient's expectations and failure to gain the patient's acceptance and satisfaction constitutes a psychological failure. It is hi
Bronchial asthma: Bronchial asthma is characterised by bouts of dyspnoea as a result of temporary narrowing of bronchi due to bronchial spasm, mucosal edema and thick secret
For Dalmation dog, the spotted condition is dominant to non-spotted. a) Using a Punnet square, show a cross between two heterozygous parents. b) A spotted female Dalmation dog is m
Explain the Sponge Method? In the sponge method, sterilized sponge with 45 x 5 cm contact surface and free from antimicrobial agent is used. Aseptically, it is moistened with 1
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. Which is the form of protozoan reproduction that generates more variability? Sexual reproduction always generates extra genetic variability than asexual reproduction. That i
Vaccinia-like disease Smallpox caused by variola virus (VARV) has successfully been eradicated in the last quarter of the 20th century. However, vaccinia like viruses (VLVs) , viz.
Parts of a Seed Seed is attached to the fruit by a stalk, the funiculus (funicle). The prolongation of the funiculus running along the seed and terminating at the chalaza is
how can i earn money by submitting assignments?
Q. What are the main characteristics of the age pyramids of developed countries? In the stabilized human population the age pyramid has a narrower base since the reproduction r
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd