Falling death rate, Biology

Assignment Help:

State the changes in society which could contribute to a falling death rate.

The changes in society which could contribute to a falling death rate are:

 (i) improvements in clean water, sewage disposal and sanitation,

 (ii) Better health care, containing immunisation programmes,

 (iii) Improved standards of nutrition and housing,

 (iv) Better education, leading to the changes listed above,

  (v) Greater wealth, leading to the changes listed above.

 


Related Discussions:- Falling death rate

Determine the psychological problems, Psychological Problems Failure to...

Psychological Problems Failure to fulfill the patient's expectations and failure to gain the patient's acceptance and satisfaction constitutes a psychological failure. It is hi

Bronchial asthma, Bronchial asthma: Bronchial asthma is characterised ...

Bronchial asthma: Bronchial asthma is characterised by bouts of  dyspnoea as a result of  temporary narrowing of bronchi due to bronchial spasm, mucosal edema and thick secret

What are the genotype and phenotype of the unknown male, For Dalmation dog,...

For Dalmation dog, the spotted condition is dominant to non-spotted. a) Using a Punnet square, show a cross between two heterozygous parents. b) A spotted female Dalmation dog is m

Explain the sponge method, Explain the Sponge Method? In the sponge met...

Explain the Sponge Method? In the sponge method, sterilized sponge with 45 x 5 cm contact surface and free from antimicrobial agent is used. Aseptically, it is moistened with 1

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Form of protozoan reproduction, Q. Which is the form of protozoan reproduct...

Q. Which is the form of protozoan reproduction that generates more variability? Sexual reproduction always generates extra genetic variability than asexual reproduction. That i

Zoonoses disease-vaccinia-like disease, Vaccinia-like disease Smallpox caus...

Vaccinia-like disease Smallpox caused by variola virus (VARV) has successfully been eradicated in the last quarter of the 20th century. However, vaccinia like viruses (VLVs) , viz.

Parts of a seed , Parts of a Seed Seed is attached to the fruit by a ...

Parts of a Seed Seed is attached to the fruit by a stalk, the funiculus (funicle). The prolongation of the funiculus running along the seed and terminating at the chalaza is

Botany, how can i earn money by submitting assignments?

how can i earn money by submitting assignments?

Characteristics of the age pyramids of developed countries, Q. What are the...

Q. What are the main characteristics of the age pyramids of developed countries? In the stabilized human population the age pyramid has a narrower base since the reproduction r

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd