Factors associated with accident, Biology

Assignment Help:

Factors Associated With Accident

Cost in Administrative Functions

Loss of prestige.
Costs for notification, investigation and legal action.
Loss of public confidence in product and company.

Other Costs

Fines, penalties imposed for failure to fallow safety guidelines
Increased insurance.
Cost of litigation.
Compensation of worker.

Related Discussions:- Factors associated with accident

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Describe insulin resistance in non-conventional factors, Describe Insulin r...

Describe Insulin resistance in Non-conventional Factors ? Insulin resistance refers to a generalized metabolic disorder in which various tissues are resistant to normal levels of

Tisues, digram or mammalian testis

digram or mammalian testis

Give some human diseases caused by protozoans, Q. What are other important ...

Q. What are other important human diseases caused by protozoans? Some other significant protozoan infections are amebiasis, trichomoniasis, giardiasis, leishmaniasis, meningoen

Respiration in birds, how do birds respire while flying??

how do birds respire while flying??

Fiehes test and aniline chloride test, Q. Fiehes test and Aniline chloride ...

Q. Fiehes test and Aniline chloride test? Determine the adulteration in the given honey sample by Fiehe's test and Aniline chloride test This activity will help you to: •

Maintenance of the normal quantity of chromosomes, Q. Why is meiosis signif...

Q. Why is meiosis significant for the maintenance of the normal quantity of chromosomes of a species with sexual reproduction? A reduction to a half of the maximum normal quant

Define the integrity of gut or colon - dietary fiber, Define the Integrity ...

Define the Integrity of gut or colon? Dietary fibre especially fermentable fibres play an important role in maintaining the integrity of gut. SCFAs generated during fermentatio

Excitation of heart - circulation, Excitation of Heart - Circulation T...

Excitation of Heart - Circulation The heart has an inherent capacity to contract rhythmically without any external stimulus. Proof of this is obtained when we see that the hea

Define intentional adulteration - types of adulteration, Define Intentional...

Define Intentional Adulteration - Types of Adulteration? In intentional adulteration, the substance is added, removed or substitute knowingly by the adulterator for the purpose

Write Your Message!

Name

Email id

Message

Verfication Code

User Account

All Pages