Eyeball - choroid, Biology

Assignment Help:

CHOROID -

  • Thin, net like made up of connective tissue, rich in blood vessels.
  • Pigment present, red in rabbit, brown or black in man. It reduces internal reflection.
  • Except cornea this layer is attached to sclerotic.
  • In front of cornea this layer froms a thin coloured partition i.e. iris. IRIS -
  • It is perforated in the middle by an aperture pupil. Iris is highly muscular
  • Circular and radial muscles are present. Circular muscles are sphincter type. Radial muscles are dilator type.
  • On contraction of circular muscles diameter of pupil is reduced it is myosis, it takes place in sharp light.
  • On contraction of radial muscles diameter of pupil is increased, it is mydriosis, it occurs in dimlight.
  • Atropine is used to dialate pupil.

2037_choroid.png

  • Basal part of iris is highly muscular having circular, radial and obligue muscles. It is known as cilliary body.
  • On its free surface 70 - 80 cilliary processes present secretes aquous humour in aquous chamber.
  • Cilliary body also affects convexity of lens.

1261_choroid1.png


Related Discussions:- Eyeball - choroid

Secondary induction, Secondary Induction The two primary inductive ev...

Secondary Induction The two primary inductive events that we have described so far are significant in the patterning of early embryo. But there are another such signaling eve

Define vaccine immunogenicity, Immunogenicity Based on immunogenicity s...

Immunogenicity Based on immunogenicity studies and experience with other vaccines, the new meningococcal conjugate vaccine (Menactra) should be highly effective in preventing m

Improvement of cereal proteins - mutual supplementation, Define Improvement...

Define Improvement of cereal proteins - Mutual supplementation? Improvement of cereal proteins: Cereals, in general, are limiting in lysine and threonine while legumes, milk, m

Phylum apicomplexa - protozoan, Phylum Apicomplexa - Protozoan Charact...

Phylum Apicomplexa - Protozoan Characteristic set of organelles (apical complex) asssociated with the anterior end present in some developmental stages. Cilia and flagella abs

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What are the elements that constitute the stomata, What are the elements th...

What are the elements that constitute the stomata? The Stomata is made of a central opening the ostiole or slit delimited by two guard cells responsible for its closing or open

Explain management of ledge - non-surgical endodontic, Explain Management o...

Explain Management of Ledge - Non-Surgical Endodontic Retreatment Place a bend of approximately 45 degree in the apical 1-2 mm of a #15 to 25 file. By gentle reciproca

Elaborates congenital aortic stenosis in details, Elaborates Congenital Aor...

Elaborates Congenital Aortic Stenosis in details? More common in males (4: 1). High incidence of Bicuspid Aortic valve. Murmur present from early infancy and sometimes at birth

Prawn.., Ask question #Minimum 2o pages accepted#

Ask question #Minimum 2o pages accepted#

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd