Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
WALL OF EYE BALL -
Outer to inner 3 layers present.
1. Sclerotic or fibrous Tunic
2. Choroid or uvea or vescular Tunic.
3. Retina or neuro sensory tunic.
Sclerotic and choroid are mesodermal while retina is ectodermal in origin.
Explain about the Cyanocobalamin (vitamin B 12 )? Vitamin B 12 (cobalamin, cbl) is a unique vitamin in human nutrition, since its malabsorption leads to the fatal syndrome of
What are the functions of biotin and pantothenic acid for the body? How are these vitamins obtained? Biotin (also called as vitamin B8) is a vitamin that acts in the metabolism
Explain the Properties of Good Prebiotic? Thus, to summarize, we can say that a good prebiotic should have the following properties: Be active at a nutritionally feasibl
explain why it is essential that muscle cells, during anaerobic respiration, convert pyruvic acid(pyruvate) into lactic acid, even though the conversion results in an accumulation
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. Explain Atherosclerosis? Atherosclerosis is one of the most important causes of morbidity and mortality in developed as well as in developing countries. Atherogenesis occurs
A biologist examines a series of cells and counts 140 cells in interphase, 10 cells in metaphase, 4 cells in anaphase and 7 cells in telophase. if complete cell cycle requires 24 h
Q. Summarize the cellular and molecular events of bone formation? The events involved in osseous wound healing at implants recapitulate the events of wound healing. Haemostasi
Q. Which all are the living beings that carry out photosynthesis? Which is the cell organelle responsible for the absorption of light for the photosynthesis process in algae and pl
Q. Are there any bacteria made of more than one cell? There are no pluricellular bacteria. All bacteria are unicellular prokaryotic.
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd