Eye ball, Biology

Assignment Help:

WALL OF EYE BALL -

Outer to inner 3 layers present.

1. Sclerotic or fibrous Tunic

2. Choroid or uvea or vescular Tunic.

3. Retina or neuro sensory tunic.

Sclerotic and choroid are mesodermal while retina is ectodermal in origin.

780_eye structure.png


Related Discussions:- Eye ball

Explain rectangular full mucoperiosteal flaps, Explain Rectangular Full Muc...

Explain Rectangular Full Mucoperiosteal Flaps - Endodontic Surgery      a. Releasing and relaxing "vertical" incisions, with the Horizontal incision, b. Causes re

Explain potential effect of nutrient and drug interaction, Explain Potentia...

Explain Potential Effect of Nutrient and Drug Interaction? The extent of the effects of any food and drug interaction call varies. Potential effects depend on the dose and the

What is karyotype, What is karyotype? The name karyotype is given to th...

What is karyotype? The name karyotype is given to the set of chromosomes of an individual, generally when visualized and identified under the microscope. The visualization usua

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

How do white cells differ from red cells, How do white cells differ from re...

How do white cells differ from red cells (a) In their structure, (b) Their function?   a) White cells have nuclei, red cells do not have nucle

What are the enzymes, Q. What are the enzymes? What is the significance of ...

Q. What are the enzymes? What is the significance of enzymes for living beings? Enzymes are proteins that are catalysts of the chemical reactions. From Chemistry it is known as

Magnesium - mineral elements, Magnesium -  It is available in most of t...

Magnesium -  It is available in most of the plants, especially vegetables. By its deficiency diarrhoea is caused. Its important functions are - (a)      Along with c

Slow moving waters - biota of rivers, Slow Moving Waters - Biota of Rivers ...

Slow Moving Waters - Biota of Rivers The habitat of a slowly moving part of the river is very different from the one just described. Here the water flow is comparatively slow

If jean-baptiste de lamarck was correct so result will be, If jean-Baptiste...

If jean-Baptiste de Lamarck was correct, than a. Natural selection would lead to the spread of favourable traits within a population b. Finches that stretched their beaks to access

Explain the management of furcal perforation, Explain the Management of Fur...

Explain the Management of Furcal Perforation 1 st isolate the perforation site. If the perforation is mechanical accidentally occurred:   a- It is probably

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd