Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
WALL OF EYE BALL -
Outer to inner 3 layers present.
1. Sclerotic or fibrous Tunic
2. Choroid or uvea or vescular Tunic.
3. Retina or neuro sensory tunic.
Sclerotic and choroid are mesodermal while retina is ectodermal in origin.
Explain Rectangular Full Mucoperiosteal Flaps - Endodontic Surgery a. Releasing and relaxing "vertical" incisions, with the Horizontal incision, b. Causes re
Explain Potential Effect of Nutrient and Drug Interaction? The extent of the effects of any food and drug interaction call varies. Potential effects depend on the dose and the
What is karyotype? The name karyotype is given to the set of chromosomes of an individual, generally when visualized and identified under the microscope. The visualization usua
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
How do white cells differ from red cells (a) In their structure, (b) Their function? a) White cells have nuclei, red cells do not have nucle
Q. What are the enzymes? What is the significance of enzymes for living beings? Enzymes are proteins that are catalysts of the chemical reactions. From Chemistry it is known as
Magnesium - It is available in most of the plants, especially vegetables. By its deficiency diarrhoea is caused. Its important functions are - (a) Along with c
Slow Moving Waters - Biota of Rivers The habitat of a slowly moving part of the river is very different from the one just described. Here the water flow is comparatively slow
If jean-Baptiste de Lamarck was correct, than a. Natural selection would lead to the spread of favourable traits within a population b. Finches that stretched their beaks to access
Explain the Management of Furcal Perforation 1 st isolate the perforation site. If the perforation is mechanical accidentally occurred: a- It is probably
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd