Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Extraradicular Infections
Whatever the cause of post endodontic disease we should do proper diagnosis to determine what is the cause; is it intra or extraradicular infection , what is the reason of failure;
is it as a result of improper instrumentation--->repeat it conventionally
If there is another problem---> need endo. Treatment
So, I should do proper diagnosis to determine proper treatment plan
What are Flavanols? Examples are catechin and epicatechin. You may have heard of the benefits of tea. Some of them are due to gallic acid, which is combined with epicatechin. F
Define role of Lipids in Controlling Gene Expression? In the lipogenic pathway, the genes that encode the enzymes of the fatty acid synthase complex are co-ordinately expressed
State in brief about respiration When we breathe in the air, our chest expands and air is taken in the lungs and when we breathe out chest returns to its resting position. This
a) The West of Scotland Coronary Prevention Study (WOSCOPS): The study randomized healthy men between the ages of 45 and 64 years with TC levels higher that 252 mg/dL and LDL chole
Question: (i) Which species of microalgae are associated with ciguatera fish poisoning? (ii) Name five fish species generally implicated in ciguatera fish poisoning in Mau
Define Mini Nutritional Assessment (MNA) Tool? It is a comprehensive and simple tool, which is able to categorize the subjects into three different categories like well nourish
Bud Dormancy - Plant Growth Substances Environmental Factors The most important factor inducing dormancy appears to be photoperiod. Short days induce dormancy in many w
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Reality Theory Developed in the 1960s by Willian glasser, a psychiatrist, reality therapists view human nature in terms of behaviour. They believe that human behaviour i
how to do assignment on alimentory canal
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd