Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
In radially symmetric animals there is no posterior, or anterior, right sides to the animal. Rather we refer to two sides of the animal by referring to the location of the mouth. In this case, side opposite the mouth.
What is Coelom - Body Cavity explain? Among the bilaterally symmetrical organisms, animals have three different types of body plans with respect to body cavities. The term coel
Define Muscular strength component for physical fitness? It is the ability of a muscle to exert force for a brief period of time. Upper-body strength, for example, can be measu
Q. Nutrient requirement during angina pectoris? The nutrient requirement here is the same as discussed earlier, however, to sum up it can be said that we need to restrict calor
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
In mountain rabbits, the EL-1 gene is located on chromosome 3. Four alleles of this gene have been identified in the population. With respect to EL-1, what is the maximum number of
What is the mRNA sequence to this DNA sequence : Guanine, cytosine, adenine, adenine, thymine, guanine
Write the positive ion isoelectronic with neon The positive ion isoelectronic with neon must have 10 electrons and 11 protons, and thus must have an atomic number = 11. This i
Barker’s in Utero Hypothesis The developmental origins of adult disease, often called as the ‘Barker hypothesis’ states that adverse influences early in development, particula
Define precaution for estimation of vitamin c in lemon juice? 1. Rinse all glassware with 3% metaphosphoric acid before you begin your practical and subsequently each time you
A haem British English or heme American English is a prosthetic group which having of an iron ion contained in the middle of a huge heterocyclic organic ring called as a porphyrin.
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd