Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Vitamin B Complex
The vitamin B complex comprises the vitamins B1, B2, B6 and B12 as well as the vitamin B factors biotin, folic acid, nicotinic acid and its amide as well as pantothenic acid. Besides, inositol, choline and adenine (vitamin B4) are considered as vitamins of the B complex. In nature, the active principles of the vitamin B complex mostly occur together.
Describe DNA replication in details? Replication : DNA replicates itself by first breaking the hydrogen bonds between the nitrogen base pairs, and "unzips" itself into two s
Explain the Future challenges for Neuroscience? When the analysis of single cells and even networks has progressed very nicely, there still remain many significant questions. A
How much Protein should be taken for Management of Obesity? Adequate amount of proteins should be included in the diet to ensure proper metabolism and prevent weakness which is
Define Principle of Detection of Metanil Yellow? Non-permitted colours like lead chromate, metanil yellow, auramine, rhodamine B are used to brighten the foods especially spice
Q. Do the -H groups bound to the central carbons participate in the peptide bond? The central carbons themselves, the -R groups and the hydrogen attached to the central carbons
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. Explain Reproducibility of Venricular Ectopy ? Experimentally it has been shown that PVCs are frequently seen at the inception of acute ischaemia. Thus, exercise induced PVC
Pericarditis Nursing Management Monitor-blood pressure, Pulse temperature, respiration, chills disphoresis, jugular pressure. Assess for signs of cardiac tarnponad
Brain Neurosecretory Cells and their Hormones Kopec was the very first to suggest the role of hormones in controlling metamorphosis. On the base of his experiments on the lar
GENERA L MECHANISM OF BLOOD COAGULATION - All researchers agree that blood clotting is a cascade mechanism and involves three essential steps - (a) Formation of prothrombin ac
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd