Explain viruses and their classification, Biology

Assignment Help:

Explain Viruses and their classification?

Viruses are living organisms. Viruses are not living organisms.

No, the above is not a misprint! In fact, viruses defy the normal classification schemes that are applied to living things. First of all, they clearly lack the cellular organization that all living organisms possess. Viruses do not possess the metabolic machinery that would enable them to make proteins or to carry out metabolic processes such as respiration and photosynthesis, convert energy, acquire food, build structures, and reproduce. So right off the bat, viruses do not conform to the defining features that characterize life.

Viruses are considered to be the simplest living organisms. In fact, there are those who would not classify them among the living because they lack the organization of a "true" cell, and must rely upon true cells to reproduce. They basically consist of nucleic acids wrapped in a protein coat.

While viruses do not conform to the traditional definition of life - that is, they are not cells, and they do not reproduce by themselves - they do represent the most fundamental mechanisms of living systems. Some think of viruses as the extreme end of the evolutionary process, where they have evolved to the point of not needing the metabolic machinery that sustains the functions of cellular life. In other words, if viruses can get other cells to perform the processes of reproduction, energy trapping and conversion, then there is no need to build and maintain these organelles themselves!

Other scientists think that viruses are left over from the very first life forms to evolve, the prototypes of cells. Yet other scientists are fragments, or parts of genetic material that broke off from living cells.

Viruses are therefore difficult to classify. They do not fall under any of the traditional groupings of organisms, and so some have suggested that they represent their own kingdom. But because the viruses do not have a common ancestry, they do not lend themselves to such a grouping. About the only traits that viruses have in common are their tiny size, their simple structure, and their parasitic life style.

Viruses are very small - measuring on average between 20 and 300 nanometers across, which is about the size of the smallest bacteria. Also unlike cells, viruses are particles that can be crystalized. Some scientists refer to these particles as "active particles" because they interact with living cells. There are different types of viruses. Some contain DNA (single or double stranded), others RNA (single or double stranded). The RNA and DNA come as either linear or circular molecules, containing anywhere from 4 to a few hundred genes.

The "head" of a virus is made of a protein container called a capsid. The capsid comes in a variety of shapes and sizes - helical, polyhedral, cuboidal, or rectangular. The capsid itself is composed of building block protein subunits called capsomeres. Some types of viruses have an envelope that surrounds the capsid, which is similar to a cellular membrane. The capsid encloses the viral particle, sometimes referred to as the virion, and in some cases, also an enzyme.

LYTIC VIRUSES

Click on the Multimedia button on the left to view the life cycle of a lytic virus.


Related Discussions:- Explain viruses and their classification

Which term describes hereditary with high level of uric acid, In studies of...

In studies of human body, which of the below terms is used to describe hereditary condition associated with an excessively high level of uric acid in blood? a) Uric ptosis b

Define commodity topics of food science, Define Commodity Topics of Food Sc...

Define Commodity Topics of Food Science? All issues of food science and technology of certain commodity groups, including milk and milk products (fluid milk and derivatives, ic

Define poverty alleviation to control under nutrition, Define Poverty Allev...

Define Poverty Alleviation to control under nutrition? There are a number of development programmes aiming at employment assurance to the landless and other labour with a focus

Evolution of metazoa, Evolution of Metazoa The sponges, coming under p...

Evolution of Metazoa The sponges, coming under phylum Porifera are the closest to Protista, and can perhaps be regarded even as a colony of protists rather than being multicel

Explain the importance of cellulose, Importance of cellulose About one ...

Importance of cellulose About one third of the world's production of  purified cellulose is  used as the base material for a number of water-soluble derivatives with predesigne

Soil water-physical properties of soil, Soil Water Soil water relations...

Soil Water Soil water relationship is very important. In the fist place the supply of large quantities of water is necessary to satisfy the evapo-transpiration requirements of

Explain cardiopulmonary resuscitation, Explain Cardiopulmonary Resuscitatio...

Explain Cardiopulmonary Resuscitation? The heart rhythm associated with cardiac arrest can be either ventricular fibrillation/ ventricular tachycardia (VT/VF) or other rhythms

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Transcription of eukaryotic protein coding genes, 1. The transcription and ...

1. The transcription and replication of DNA requires a multitude of protein complexes a. Describe the events that occur during the initiation of transcription of eukaryotic prot

Demonstrate the cause of the mutant trait, A protein that is normally a sin...

A protein that is normally a single-pass transmembrane protein is absent from the cell surface of the mutant cell line YTM-15. When labeled so that the protein can be localized, yo

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd