Explain venous thromboembolism, Biology

Assignment Help:

Venous Thromboembolism

Prolonged immobilization (>8 hours) increases the risk of lower extremity deep vein thrombosis (DVT), particularly in travelers with risk factors for thrombosis. Nevertheless, flight-related symptomatic pulmonary embolism is rare.To minimize the risk, travelers should be advised to walk around or exercise while sitting by flexing/extending ankles and knees, to drink plenty of fluids and to avoid alcohol. Compression stockings can decrease the risk of asympto- matic DVT. One study found that giving a single dose of a low-molecular-weight heparin or aspirin as pro- phylaxis to travelers at high risk (past history of thrombosis, obesity, malignancy, increased platelets) reduced the incidence of DVT, but there is little evidence supporting this approach.

 


Related Discussions:- Explain venous thromboembolism

How can the hypothesis that asserts that chloroplasts, How can the hypothes...

How can the hypothesis that asserts that chloroplasts as well as mitochondria were primitive prokaryotes that associated in mutualism with primitive anaerobic eukaryotic cells be c

Connective tissue and its types, CONNECTIV E TISSUE Connective tiss...

CONNECTIV E TISSUE Connective tissues are formed by the mesoderm of the embryo. Three components are present in the connective tissues- (i) intercellular medium

Explain three parts of homogenate, Differential centrifugation divides cell...

Differential centrifugation divides cellular components based on the differences in their size and / or density. A tissue sample was homogenized and three parts (aliquots) of this

glycolysis, explain glycolysis briefly? elaborat

explain glycolysis briefly? elaborate

Nutrion, what are the different modes of nutrition

what are the different modes of nutrition

Explain about the dietary calcium requirements, Explain about the Dietary C...

Explain about the Dietary Calcium Requirements? There are variations in the amount of calcium recommended by different advisory groups. This is mainly due to the different crit

What is active transport--secretion, What is Active Transport--Secretion ...

What is Active Transport--Secretion This method is now a well accepted process of aqueous formation. The rate of aqueous humour formation depends on the rate of active solute

What is the other name given to sex chromosomes, What is the other name giv...

What is the other name given to sex chromosomes? What is the function of sex chromosomes? Sex chromosomes are also known as allosomes (the other chromosomes that are not sex ch

Determine about benefits of jogging, Determine about benefits of Jogging ...

Determine about benefits of Jogging Jogging gives a sense of wellness to a diabetic patient. The frequency of jogging should be at least 3 days in week with a distance of 2 km

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd