Explain unacceptable aesthetics, Biology

Assignment Help:

Unacceptable Aesthetics

The implant which has successfully integrated with bone may still be a failure if the Prosthesis which it is designed to support does not meet with the aesthetic requirements of the patient.

 


Related Discussions:- Explain unacceptable aesthetics

State the limitations of intra oral periapical radiographs, Limitations of ...

Limitations of Intra Oral Periapical Radiographs  It is not optimal in pre operative planning of cases with severely resorbed ridges  Anatomical structure of importance can'

What are cerebrovascular accidents, Q. What are cerebrovascular accidents? ...

Q. What are cerebrovascular accidents? The Cerebrovascular accident (CVA), as well known as stroke, is the generic name given to infarction (tissue and cellular death by hypoxi

Which substance starts clotting in humans after a wound, When a wound occur...

When a wound occurs in humans, platelets in the blood activate a substance that starts clotting process. The substance which starts clotting is: a) Adenosine (pron: ah-den-ah-s

Experimenting, what are some examples of eperimenting palants?

what are some examples of eperimenting palants?

Explain the feeding process for preschoolers, Explain the Feeding process f...

Explain the Feeding process for Preschoolers? The word preschool children, you may be aware, is used for children less than six years of age. After the first year, there is a s

Approach grafting, Approach grafting In this method both scion and s...

Approach grafting In this method both scion and stock remain rooted. A small slice is cut off from the stem of scion and stock. Scion is bent towards the stock. The two c

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Secretion of hormones, Secretion of Hormones The secretion of most hor...

Secretion of Hormones The secretion of most hormones (except steroid) is by the process of exocytosis. Figure summarises the formation, transport, release and reconstitution o

What are the three cell types that form the osseous tissue, What are the th...

What are the three main cell types that form the osseous tissue? What are their functions? The three major cell types of the osseous tissue are the osteoblasts, the osteocytes

Pathology, Pathology: This concerned with the identification of different d...

Pathology: This concerned with the identification of different diseases, causative organs, their prevention and control methods. Pathology is a kind of study or diagnosis of diseas

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd