Explain the various types of protein structure, Biology

Assignment Help:

Explain the various types of Protein Structure?

Protein Structure :  The structure of proteins can be examined at four levels of increasing complexity, with the primary structure being the simplest, and the quaternary structure being the most complex.

Primary Structure

The linear joining of amino acids forms the primary structure. The covalent bonds formed in the condensation reaction are called peptide bonds. The joined amino acids are peptides, or, as they form larger molecules, polypeptides.

Secondary Structure

Chains (primary structures) of amino acids can fold upon one another to form a right-handed coil (alpha helix), a folded, or pleated, sheet (beta sheet), or a twisted cable (triple helix). These secondary structures are held together by hydrogen bonds between amino acids in the chain.

The most common type of secondary structure is an alpha helix, or a-helix, which forms when hydrogen bonds arise between the amide group in one polypeptide and the carboxyl group of another. An example of the alpha helix is keratin, the structural basis of hair, skin, fingernails, and other protective tissues.

Secondary structures may also be formed as b-pleated sheets, in which the protein chains are extended and assembled into sheets by hydrogen bonds between adjacent chains. Beta sheets can form the basis for globular proteins. Globules can then become grouped to form various shapes joined by electrostatic interactions, hydrogen bonds, and occasionally by disulfide bonds.

In the third type of secondary structure, called a triple helix, three polypeptide chains are twisted together like strands of a cable. An example is collagen, a protein found in supporting structures such as cartilage, ligaments, and tendons, and other parts of the body. Cartilage is a translucent elastic substance that composes most of the skeleton of higher animals in early development but is eventually usually replaced by bone. Ligaments are the tough elastic fibers that hold bones in a joint together, such as those in your knees. Tendons are dense white fibers that connect muscle to bone.

Tertiary Structure

Secondary structures are further organized into more complex tertiary structures. Tertiary structures are formed when secondary protein structures such as alpha-helices or beta-pleated sheets become folded in very specific shapes.

Quarternary Structure

Some proteins are made up of two or more polypeptide chains that can be joined together in a certain way to form a functional protein called a quarternary structure. The red blood cell pigment hemoglobin, for example, is composed of four polypeptide strands that wrap themselves around a heme group, an iron-containing ring that binds oxygen.

Polypeptide chains can be made to unfold, or become denatured, by gentle heating or chemical treatments. If heat or chemical treatment is not too rigorous, under the proper conditions the protein can often reassemble to form the original quaternary structure.


Related Discussions:- Explain the various types of protein structure

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Show the ph range of natural honey, Q. Show the pH range of natural honey? ...

Q. Show the pH range of natural honey? The pH of natural honey ranges from 3.4 to 6.1. Acidity of honey is primarily due to presence of acids such as gluconic acid, pyruvic a

Spermatogenesis, SPERM A T OGENESIS The process of maturation of ...

SPERM A T OGENESIS The process of maturation of reproductive cells in the testes of male to form spermatozoa (sperm) is known as spermatogenesis. The testes are formed

Instrument for measurement of absorbed radiation-colorimeter, Define Instru...

Define Instrument for measurement of absorbed radiation-Colorimeter? The simplest types of, photometric instruments are designed for measurements in the visible region of spect

Common symptoms linked to lactose intolerance, Q. Common symptoms linked to...

Q. Common symptoms linked to lactose intolerance? Common symptoms linked to lactose intolerance include: 1. Anorexia and nausea. 2. Intestinal distension 3. Abdominal

Carbonization process, When coal is heated strongly in absence of air, it f...

When coal is heated strongly in absence of air, it forms a strong, porous, dense and coherent mass known as coke. This process of conversion of coal into coke is called carbonzatio

What are the other substances resorbed by nephron tubules, Where does most ...

Where does most of the water resorbed after glomerular filtration go? What are the other substances resorbed by the nephron tubules? Only 0.5 to 1% of the glomerular filtrate i

Describe the basic function of platelets, Q. What is the function of platel...

Q. What is the function of platelets? What consequences does the clinical condition known as thrombocytopenia yield? Platelets, also known as thrombocytes are fragments of gian

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd