Explain the use of enzyme assay, Biology

Assignment Help:

Explain the use of Enzyme assay

Enzyme assay is also used for research into such processes as the browning of plant products which poses problems during value addition. The browning process involves the cyanide-resistant uptake of oxygen, which oxidizes phenols to quinines resulting in the formation of dark melanins. In wine preparation, the concentration of malic acid is sometimes determined by a method involving malate dehydrogenase.

 


Related Discussions:- Explain the use of enzyme assay

Protection against insect bites, Protection Against Insect Bites To mi...

Protection Against Insect Bites To minimize insect bites, travellers should wear light-colored, long-sleeved shirts, pants and socks. The most effective topical insect repelle

Define atherosclerosis, Q. Explain Atherosclerosis? Atherosclerosis is ...

Q. Explain Atherosclerosis? Atherosclerosis is one of the most important causes of morbidity and mortality in developed as well as in developing countries. Atherogenesis occurs

Kingdoms, The organisms that live in hostile environments that cannot suppo...

The organisms that live in hostile environments that cannot support other forms of life are members of what kingdom?

Germinative zone , what is the function of the germinative zone

what is the function of the germinative zone

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Disease prevention for the high risk group, Disease Prevention for the High...

Disease Prevention for the High Risk Group   Interventions aimed at early diagnosis and appropriate management for reducing morbidity and mortality targeting people who suffer

What are the cardiac muscles, What are the Cardiac muscles We know tha...

What are the Cardiac muscles We know that the heart muscles (cardiac muscles) are not under the control of  mind. The day we are born, it starts its activity and the day peopl

Nonsurgical retreatment will be the preferred choice, Nonsurgical retreatme...

Nonsurgical retreatment will be the preferred choice -Less invasive .. not cause problem to the pt. -Less traumatic postoperative .. most probably no post operative pain

Show some examples of migratory animals, Q. What are some examples of migra...

Q. What are some examples of migratory animals? Instance of the migratory animals are southern right whales from Antarctica, that procreate on the Brazilian coast; the migrator

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd