Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Explain the Turbidity Measurement?
Presence of sufficient number of microbes makes the liquid medium turbid. Turbidity also increases with the multiplication of microbes. Estimation of turbidity can be used both for the quantitation of microbes and monitoring microbial growth. The technique depends on the fact that cells scatter the light striking them and the amount of scattering is directly proportional to the biomass of cells present and indirectly to the cell number. The scattering of light can be measured by spectrophotometer or photometer. In the instrument, a beam of light is passed through a cell suspension and the amount of unscattered light is detected by a light sensitive detector. Photometer uses a simple filter to generate incident light whereas in spectrophotometer, prism is used instead of a filter. Commonly used wavelengths for bacteria are 540 nm, 600 nm and 660 nm. More the number of microbes in the suspension, less is the light reaching to the detector and read as percent transmission or absorbance (OD, optical density, a logarithmic expression).
Q. How does the sodium-potassium pump present in the cell membrane work? What is the significance of this protein for the cell? The sodium-potassium pump is the transport prote
Determine Push-ups Test for check the Body Strength? Push-ups is another test done to measure muscular strength, as well as, endurance and done on a parallel bar. The subject
Determine the blood plasma levels of glucagon A. production in the liver increases in response to an increase in blood plasma levels of glucagon. B. is secreted by alpha-isl
The PCR (polymerase chain reaction) is a biochemical technology in molecular biology to intensify a one or a little copies of a piece of DNA across several orders of magnitude gene
Ensuring Food Safety It is now well-known that the end product inspection and testing does not provide safety of food. It has inherent limitation of mapping the potential ha
Explain the Synthetic and natural materials of suturing 1. Most common are synthetic fibers: nylon, polyester, polyglactin (PG), and polyglycolic acid (PGA). 2. Natural: sil
Clinical symptoms of typhoid are: 1. Graded fever which follows an upward ladder pattern. 2. Abdominal pain, cramps and diarrhoea. 3. Anorexia and vomiting. 4. In
If we make a cross of two phenotypically WT zebrafish, and we get the following results, what can we say about the genotype of those two WT looking parents from the following resul
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
When constructing phylogenies using maximum likelihood methods, you assume?
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd