Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Explain the term active transport?
Active Transport : At intervals, protein assemblies involved in selective, or active transport of materials are inserted into the cell membrane. These specialized proteins use chemical energy to alter their chemical structure to pump molecules of dissolved substances into or out of the cell, from an area of low concentration of solute to a higher concentration, opposing the action of diffusion.
The part of the molecule to which the transported substance attaches is called the binding site. An example of active transport is the sodium-potassium pump, which is responsible for carrying electrical impulses down nerve cells, through contracting muscles, and in other control processes in cells. This process will be described more fully later.
Q How does mitosis participate in the growth of pluricellular organisms? All pluricellular beings grow with the raise in quantity of their cells. This raise is produced by mito
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Peptide bond formation is catalyzed by peptidyl transferase. The carboxyl end of the amino acid bound to the tRNA in this reaction and in the P site is uncoupled from the tRNA a
Explain benefits of Protein Protein: Once the energy requirements have been estimated, protein requirements can be addressed. The aim is to achieve nitrogen balance. There are
what''s you''re name
a) Explain what is meant by ovulation. b) How often does it happen in humans? (a) Ovulation is the release of an ovum from a mature follicle in the ovary.
Class of Crustacea - Branchiura Branchiura involves only around 130 species of ectoparasitic crustaceans living mostly on the integument and gill cavities of freshwater and ma
Significant proportion of starch in the normal diet A significant proportion of starch in the normal diet escapes degradation in the stomach and small intestine and is labeled
What is the nitrogen cycle? The nitrogen cycle represents the circulation and recycling of the chemical element nitrogen in nature. The nitrogen cycle basically depends on t
Define Historical example for scaling from individual to ecosystems? Biological oceanographers have long utilized physiologically based models like the Droop model, which reduc
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd