Explain the spinal cord and its function, Biology

Assignment Help:

Spinal cord

The elongated part of CNS that runs downward in the spinal canal as continuationof medulla oblongata is called spinal cord.

The functions of the Spinal Cord are:

Spinal cord is the link between brain and nerves of the body.

It is a pathway for carrying information to brain and sending orders to the organs.

Although, spinal cord functions under brain, it has some autonomy in performing simple actions like knee jerk.

 


Related Discussions:- Explain the spinal cord and its function

Describe arteriovenous continuous murmur, Describe Arteriovenous Continuous...

Describe Arteriovenous Continuous Murmur? Arteriovenous Continuous Murmur :  These can be congenital as in coronary artery fistula entering RA/RV/PA, sinus of valsalva to rig

Porifra, what type of body cavities present

what type of body cavities present

High proportion of reticulocytes, A patient has a low red blood cell count,...

A patient has a low red blood cell count, and microscopic examination reveals an abnormally high proportion of circulating reticulocytes. Upon subsequent examination, the patient i

Enzymology, Ethylene glycol is a poison that causes about fifty deaths a ye...

Ethylene glycol is a poison that causes about fifty deaths a year in the United States. Treating people who have drunk ethylene glycol with massive doses of ethanol can save their

What are the main interspecific ecological interactions, What are the main ...

What are the main interspecific ecological interactions? The major harmonious interspecific ecological interactions are: protocooperation, mutualism and commensalism. The major

What are zymogens, What are zymogens? Zymogens, or proenzymes, are enzy...

What are zymogens? Zymogens, or proenzymes, are enzymes secreted in inactive form. Under some conditions a zymogen shifts to the active form of the enzyme. Zymogen secretions i

Explain about the texturization, Explain about the Texturization? Prote...

Explain about the Texturization? Proteins constitute the basis of structures and texture in several foods, whether these come from living tissue (myofibrills in meat or fish) o

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Membrane protein purification and reconstitution, The first step of the pur...

The first step of the purification of an integral membrane protein is to disrupt its interactions with other integral proteins and the lipids in the membrane.  This is commonly ach

Define the meaning of vital signs, Define the meaning of Vital signs V...

Define the meaning of Vital signs Vital signs are measures of different physiological statistics, often taken by health professionals, in order to assess the most basic body f

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd