Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Spinal cord
The elongated part of CNS that runs downward in the spinal canal as continuationof medulla oblongata is called spinal cord.
The functions of the Spinal Cord are:
Spinal cord is the link between brain and nerves of the body.
It is a pathway for carrying information to brain and sending orders to the organs.
Although, spinal cord functions under brain, it has some autonomy in performing simple actions like knee jerk.
Describe Arteriovenous Continuous Murmur? Arteriovenous Continuous Murmur : These can be congenital as in coronary artery fistula entering RA/RV/PA, sinus of valsalva to rig
what type of body cavities present
A patient has a low red blood cell count, and microscopic examination reveals an abnormally high proportion of circulating reticulocytes. Upon subsequent examination, the patient i
Ethylene glycol is a poison that causes about fifty deaths a year in the United States. Treating people who have drunk ethylene glycol with massive doses of ethanol can save their
What are the main interspecific ecological interactions? The major harmonious interspecific ecological interactions are: protocooperation, mutualism and commensalism. The major
What are zymogens? Zymogens, or proenzymes, are enzymes secreted in inactive form. Under some conditions a zymogen shifts to the active form of the enzyme. Zymogen secretions i
Explain about the Texturization? Proteins constitute the basis of structures and texture in several foods, whether these come from living tissue (myofibrills in meat or fish) o
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
The first step of the purification of an integral membrane protein is to disrupt its interactions with other integral proteins and the lipids in the membrane. This is commonly ach
Define the meaning of Vital signs Vital signs are measures of different physiological statistics, often taken by health professionals, in order to assess the most basic body f
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd