Explain the solid-liquid equilibria, Biology

Assignment Help:

Explain the Solid-Liquid Equilibria?

A freezing-point curve (freezing point as a function of liquid composition) and a solubility curve (composition of a solution in equilibrium with a pure solid as a function of tempera- ture) are different ways of describing the same physical situation. Thus, strange as it may sound, the composition xA of an aqueous solution at the freezing point is the mole fraction solubility of ice in the solution.


Related Discussions:- Explain the solid-liquid equilibria

Skeletons of radiolarians, Skeletons of radiolarians The skeletons of ...

Skeletons of radiolarians The skeletons of radiolarians and foraminiferans form a primary constituent of ocean bottoms where they form 30% or more of the sediment. It is calle

Cardiac cycle, Cardiac Cycle Cardiac cycle has two phases-systole and...

Cardiac Cycle Cardiac cycle has two phases-systole and diastole. Ventricular systole and diastole occur as a result of depolarization and chamber volume and pressure. The di

Why do organisms live in certain places, Why do organisms live in certain p...

Why do organisms live in certain places? Think of that, the temperature dissimilarity in the desert is huge. So in order to survive, the cactus plant decreases heat gain and he

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Microbiology, 2. Vaccinations against various childhood diseases have contr...

2. Vaccinations against various childhood diseases have contributed to the entry of women, particularly mothers, into the fulltime workplace. a. Is this statement supported by data

Why conserve wild life ?, WHY CONSERVE WILD LIFE ? 1 .       ECONOMIC...

WHY CONSERVE WILD LIFE ? 1 .       ECONOMIC IMPORTANCE OF WILD LIFE - (i) Plants - (ii) Animals - (iii) Micro organisms - 2 .       ECOLOGICAL BALANCE -

What thiamine defiency will result in decreased activity, A thiamine defien...

A thiamine defiency will result in decreased activity of: -G-6 phosphase -transketolase -fructokinase

Fundamental aspects of protein structure, Can someone describe the fundamen...

Can someone describe the fundamental aspects of protein structure? I'm already familiar with the amino acid structure, I just don't have a clear conceptual understanding of protein

State the goals of neuropsychological assessment, State the Goals of neurop...

State the Goals of neuropsychological assessment The psychological domains/processes/ components are mediated by specific brain structures and connected brain structures formin

What is osmotic pressure, Q. What is Osmotic Pressure? Ans. Import...

Q. What is Osmotic Pressure? Ans. Important characteristic of a cell is 'osmosis'. You would recall reading about osmosis in the Applied Physiology Course in Unit 8. I

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd