Explain the root-end preparation - endodontic surgery, Biology

Assignment Help:

Explain the Root-End Preparation - endodontic surgery

a. Class I type preparation, 3mm depth.

b. Tips are designed in a length of 3 mm to prevent procedural errors.

c. Ultrasonic retrotips have superior operator control, decreased risk of perforation than the micro-handpiece. 

d. The frequency "speed" of the ultrasonic tips should not be more than 4000

e. Most ultrasonic tips are:

  • Stainless steel,
  • Diamond coated. 

 

f. Do light touch cutting with correct amount of water to prevent overheating and crack formation.


Related Discussions:- Explain the root-end preparation - endodontic surgery

Protozoan slides, Protozoans are a group of animal protists of more than 50...

Protozoans are a group of animal protists of more than 50,000 species and are found under almost all natural conditions where there is moisture. A protozoa11 is not as simple an or

Phylum platyhelminhes, what are the classification of phylum platyhelminthe...

what are the classification of phylum platyhelminthes?

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Role of microorganism in fermentation foods, Normal 0 false f...

Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4

Aschelminthes, in what part of the human body aschelminthes found?

in what part of the human body aschelminthes found?

Explain adverse effects of adefovir dipivoxil, Adverse Effects of Adefovir ...

Adverse Effects of Adefovir dipivoxil  Doses of adefovir used for HBV are generally well tolerated but may be associated with asthenia, headache, diarrhea and abdominal pain. H

Amine and the carboxyl groups, Q. Do the amine and the carboxyl groups atta...

Q. Do the amine and the carboxyl groups attached to central carbons participate in the union between amino acids? Yes. The nitrogen of the amine group of one amino acid binds t

Drugs for hepatitis b, Drugs for hepatitis B Chronic HBV infection is ...

Drugs for hepatitis B Chronic HBV infection is currently treated with interferon alfa, lamivudine or adefovir. Lamivudine is much better tolerated than interferon and much les

Of which substance are microtubules made, Of which substance are microtubul...

Of which substance are microtubules made? In which structures and cellular processes do microtubules participate? Microtubules are made of consecutive dimers of the protein tub

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd