Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Explain the Quantitative Techniques?
Now that we are well-versed with the techniques involved in preparing and maintaining cultures, it is also important for us to learn how to evaluate the growth of microbial culture i.e., how to determine microbial number in a given sample. This is done through quantitative techniques, which is the focus of this practical. The direct and indirect methods of microbial estimation are highlighted in this practical.
Objectives
After studying this practical and conducting the activities given herewith, you will be able to:
Palaeobiology : This deals with the study of fossils and remains an impressions of the past organisms found in the rock of different ages. Paleobiology is a growing or comparativel
When underlying coronary artery disease is the cause of heart failure in the coronary revascularization may both improve symptoms and prevent progression. Patients with angina and
Q. What are the two major morphological patterns of cnidarians? Concerning locomotion how do these forms differentiate from each other? Morphologically, cnidarians classify as
Roan (RW) is a color of cattle in which both red and white hairs are present due to codominance. What are the phenotype and genotype ratios of offspring produced by: roan bull and
Q. What is Constipation? Constipation is irregular, infrequent or difficult passage of faeces. It is the most common physiological disorder of the alimentary tract. It is chara
Define the uses of foams The foams frequently used in cookery are whipped cream, ice cream, cake, bread, meringues, milk froth and gelatin. Food foams contain large amounts of
Describe Pulsation in cardian examination? 1) Apex impulse; lowest and outermost point of definite cardiac pulsation. 2) Prominent pulsations in left parasternal region suggest
I nfectious coryza A highly infectious bacterial disease of chickens caused by Hemop hilus paragallinarum, is characterized by catarrhal inflammation of the upper respirator
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Explain Transfer from Solid Culture to Liquid Media The steps involved in this technique are included herewith: 1. Sterilized inoculating loop or needle is touched carefully
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd