Explain the quantitative techniques - microbial culture, Biology

Assignment Help:

Explain the Quantitative Techniques?

Now that we are well-versed with the techniques involved in preparing and maintaining cultures, it is also important for us to learn how to evaluate the growth of microbial culture i.e., how to determine microbial number in a given sample. This is done through quantitative techniques, which is the focus of this practical. The direct and indirect methods of microbial estimation are highlighted in this practical.

Objectives

After studying this practical and conducting the activities given herewith, you will be able to:  

  • Discuss the different methods used for microbial estimation,
  • Enumerate the number of bacteria or other microbes in a given sample,
  • Differentiate between viable count and total count of microbes,
  • Evaluate the growth of the given microbial culture, and
  • Estimate the amount of bacteria by performing spread and pour plate techniques and serial dilution.

Related Discussions:- Explain the quantitative techniques - microbial culture

Palaeobiology, Palaeobiology : This deals with the study of fossils and rem...

Palaeobiology : This deals with the study of fossils and remains an impressions of the past organisms found in the rock of different ages. Paleobiology is a growing or comparativel

Coronary revascularization, When underlying coronary artery disease is the ...

When underlying coronary artery disease is the cause of heart failure in the coronary revascularization may both improve symptoms and prevent  progression. Patients with angina and

What are the two major morphological patterns of cnidarians, Q. What are th...

Q. What are the two major morphological patterns of cnidarians? Concerning locomotion how do these forms differentiate from each other? Morphologically, cnidarians classify as

What are the possible genotypes for its parents, Roan (RW) is a color of ca...

Roan (RW) is a color of cattle in which both red and white hairs are present due to codominance. What are the phenotype and genotype ratios of offspring produced by: roan bull and

What is constipation, Q. What is Constipation? Constipation is irregula...

Q. What is Constipation? Constipation is irregular, infrequent or difficult passage of faeces. It is the most common physiological disorder of the alimentary tract. It is chara

Define the uses of foams, Define the uses of foams The foams frequently...

Define the uses of foams The foams frequently used in cookery are whipped cream, ice cream, cake, bread, meringues, milk froth and gelatin.  Food foams contain large amounts of

Describe pulsation in cardian examination, Describe Pulsation in cardian ex...

Describe Pulsation in cardian examination? 1) Apex impulse; lowest and outermost point of definite cardiac pulsation. 2) Prominent pulsations in left parasternal region suggest

Infectious coryza, I nfectious coryza A highly infectious bacterial di...

I nfectious coryza A highly infectious bacterial disease of chickens caused by Hemop hilus paragallinarum, is characterized by catarrhal inflammation of the upper respirator

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain transfer from solid culture to liquid media, Explain Transfer from ...

Explain Transfer from Solid Culture to Liquid Media The steps involved in this technique are included herewith: 1. Sterilized inoculating loop or needle is touched carefully

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd