Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Explain the Kidney Function in human biology?
Blood first enters the capillaries in Bowman's capsule where it is filtered. The pores in the capillary walls allow water and small molecules to pass through, but are too small to allow red blood cells and large protein molecules to pass. The process by which material is filtered into Bowman's capsule is not very selective, and some of these substances that are of value to the body need to be reclaimed. Material filtered through the capillary walls into Bowman's capsule flows along the renal tubules. The process by which material is returned to the blood through the walls of the tubules is called tubular reabsorption.
Sodium, potassium, calcium, other minerals, and glucose are returned by active transport. These substances then enter the capillaries by diffusion. Water is returned by osmosis mostly in the proximal convoluted tubule, following the movement of glucose. There is additional reabsorption of salts and nutrients from the distal convoluted tubule, but this section of tubule also removes wastes and other substances not originally filtered out by Bowman's capsule through a process called tubular secretion. The pH of the blood is adjusted by the secretion of hydrogen ions into the filtrate. Potassium ions, ammonia, and certain drugs are eliminated by secretion from the distal convoluted tubules.
The loops of Henle function to concentrate the filtrate by establishing an osmotic gradient in the extracellular fluid around the loops that will later pull water from the collecting ducts. The ascending limb of the loop pumps NaCl out by active transport, but the ions cannot diffuse back in because this portion of the loop is impermeable to water. Salts can diffuse into the descending limb, but these are pumped out again when they reach the ascending loop, increasing the extracellular ionic concentration. When the filtrate reaches the collecting ducts, its osmotic concentration is much lower than the extracellular fluid of the medulla, so it loses water by osmosis and becomes more concentrated. As much as 99% of the water that goes through the tubules and collecting ducts is returned to the blood.
Which type of defense cell do bacteria attract and cause to multiply during the inflammation process? What is the name given to the waste material produced by the inflammation trig
Define Proteins as Enzymes? From conception to death, living cells use oxygen and metabolize fuel. Cells synthesize new products, degrade others, and generally are in a state o
Illustrate the Horizons in detail 'O' is the organic horizon formed from t he organic litter derived from plants and animals and fresh or partially decomposed organic materi
What is oxygen-haemoglobin dissociation curve? Explain the role of red blood cells in the transport of oxygen and carbon dioxide by blood. Briefly describe the principle, pr
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Normal 0 false false false EN-IN X-NONE X-NONE
Enumerate the history of neuropsychological The typical neuropsychological exam begins with a careful history taking. Areas of interest include: Medical history of patie
Q. Define Thrombospondin Polymorphisms Thrombospondin polymorphisms may present an initial insight into our understanding of the genetic contribution to coronary atherosclerosi
How is it explained that a person with the spinal cord sectioned at the cervical level is still able to perform the patellar reflex? The arch reflex depends only on the integr
Q. Why is the cerebellum more developed in mammals that fly or jump? The cerebellum is the main brain structure that coordinates the movement and the equilibrium of the body. F
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd