Explain the kidney function in human biology, Biology

Assignment Help:

Explain the Kidney Function in human biology?

Blood first enters the capillaries in Bowman's capsule where it is filtered. The pores in the capillary walls allow water and small molecules to pass through, but are too small to allow red blood cells and large protein molecules to pass. The process by which material is filtered into Bowman's capsule is not very selective, and some of these substances that are of value to the body need to be reclaimed. Material filtered through the capillary walls into Bowman's capsule flows along the renal tubules. The process by which material is returned to the blood through the walls of the tubules is called tubular reabsorption.

Sodium, potassium, calcium, other minerals, and glucose are returned by active transport. These substances then enter the capillaries by diffusion. Water is returned by osmosis mostly in the proximal convoluted tubule, following the movement of glucose. There is additional reabsorption of salts and nutrients from the distal convoluted tubule, but this section of tubule also removes wastes and other substances not originally filtered out by Bowman's capsule through a process called tubular secretion. The pH of the blood is adjusted by the secretion of hydrogen ions into the filtrate. Potassium ions, ammonia, and certain drugs are eliminated by secretion from the distal convoluted tubules.

The loops of Henle function to concentrate the filtrate by establishing an osmotic gradient in the extracellular fluid around the loops that will later pull water from the collecting ducts. The ascending limb of the loop pumps NaCl out by active transport, but the ions cannot diffuse back in because this portion of the loop is impermeable to water. Salts can diffuse into the descending limb, but these are pumped out again when they reach the ascending loop, increasing the extracellular ionic concentration. When the filtrate reaches the collecting ducts, its osmotic concentration is much lower than the extracellular fluid of the medulla, so it loses water by osmosis and becomes more concentrated. As much as 99% of the water that goes through the tubules and collecting ducts is returned to the blood.

 


Related Discussions:- Explain the kidney function in human biology

Which type of defense cell do bacteria attract, Which type of defense cell ...

Which type of defense cell do bacteria attract and cause to multiply during the inflammation process? What is the name given to the waste material produced by the inflammation trig

Define proteins as enzymes, Define Proteins as Enzymes? From conception...

Define Proteins as Enzymes? From conception to death, living cells use oxygen and metabolize fuel. Cells synthesize new products, degrade others, and generally are in a state o

Illustrate the horizons in detail, Illustrate the Horizons in detail 'O...

Illustrate the Horizons in detail 'O'  is the  organic horizon  formed from t he organic litter derived from plants and animals and fresh or partially decomposed organic materi

What is oxygen-haemoglobin dissociation curve, What is oxygen-haemoglobin d...

What is oxygen-haemoglobin dissociation curve? Explain the role of red blood cells in the transport of oxygen and carbon dioxide by blood. Briefly describe the principle, pr

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain about the manganese - micro minerals, Normal 0 false ...

Normal 0 false false false EN-IN X-NONE X-NONE

Enumerate the history of neuropsychological, Enumerate the history of neuro...

Enumerate the history of neuropsychological The typical neuropsychological exam begins with a careful history taking. Areas of interest include: Medical history of patie

Define thrombospondin polymorphisms, Q. Define Thrombospondin Polymorphisms...

Q. Define Thrombospondin Polymorphisms Thrombospondin polymorphisms may present an initial insight into our understanding of the genetic contribution to coronary atherosclerosi

Determine the patellar reflex, How is it explained that a person with the s...

How is it explained that a person with the spinal cord sectioned at the cervical level is still able to perform the patellar reflex? The arch reflex depends only on the integr

Why cerebellum more developed in mammals that fly or jump, Q. Why is the ce...

Q. Why is the cerebellum more developed in mammals that fly or jump? The cerebellum is the main brain structure that coordinates the movement and the equilibrium of the body. F

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd