Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Explain the Fermentability or Degradability?
As you are aware that colon contains over 400 known species of bacteria that exist in a symbiotic relationship with the host. All fibres are broken down to some extent by these microorganisms. Fermentation depends on the accessibility of the molecules to the microorganisms, which in turn depends on physical properties particularly solubility. Soluble fractions especially pectin, gums, mucilages and algal polysaccharides are very accessible and ferment rapidly. Insoluble fibre fraction ferment much more slowly. The first step in fermentation is the breakdown of polysaccharides, oligosaccharides and disaccharides to their monosaccharide subunits by hydrolytic enzymes of bacteria. Monosaccharides are further converted to various end products as seen in Figure.
Figure: Overview of carbohydrate fermentation on colon
According to the calculations by Cummings and Macfarlane, if approximately 20 g of fibre is fermented in the colon each day, 200 mM SCFA will be produced, of which 62% will be acetate, 25% propionate and 16% butyrate. Of these, butyrate is almost completely consumed by the colonic mucosa, while acetate and propionate enter the portal circulation. The mechanism by which SCFAs cross the colonic mucosa is thought to be a saturable process-passive diffusion of unionized acid into mucosal cells. In addition to these acids, other products of fibre fermentation are hydrogen, carbon dioxide and methane gases that are excreted as flatus or expired by the lungs.
The quartenary structure of a holoenzyme contains four long polypeptide subunits composed of non-polar, polar and charged amino acids. All subunits are properly folded and function
Define Fats requirements of school children and adolescents? The linoleic acid requirements for school children and adolescents have been set at 3 en%. In terms of visible fats
Mountains and their forest ecosystems are regarded as the water towers of the world. A good example is the extraordinarily massive Himalayan Mountains which have shaped the climate
modes of nutrition in animals?
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Explain Standard titration - Estimation of Vitamin C in Lemon Juice? Pipette 5 ml of standard ascorbic acid solution into a 100 ml conical flask. Fill the burette with the dye s
Types of Biogeochemical Cycles There are two basic types of biogeochemical cycles, gaseous and sedimentary. In the gaseous type of biogeochemical cycle there is a prominent ga
Define nutritional management of severe anorexia nervosa? The nutritional management of severe anorexia nervosa is therefore, considered in terms of three consecutive phases:
what are the uses of computer in biotechnology ??? briefly explain any twenty
What is the difference between homozygosity and heterozygosity? Homozygosity happens when an individual has two identical alleles of a gene, for instance, AA or aa. Heterozygos
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd