Explain the female reproductive system, Biology

Assignment Help:

Explain the Female Reproductive System?

The female reproductive system consists of the primary sex organs, the ovaries, and the accessory organs necessary to effect fertilization and to protect, nourish, and develop the embryo. Typically, females have two ovaries, lying adjacent to a duct called the Fallopian tube. The funnel-shaped end of the Fallopian tube, or oviduct, is called the infundibulum and captures mature eggs that are released by the ovary during ovulation. Fimbriae projections, or extensions, help to collect the eggs released by the ovary. The oviducts are lined with cilia that sweep the egg further down in the oviduct, where fertilization can take place.

The fertilized egg, or zygote, migrates down through the oviducts into the pear-shaped uterus, or womb, where it embeds itself into the inner lining of the uterine wall. The uterus has two layers: an inner endometrium that contains many blood vessels and glands, and an outer muscular wall that contracts to expell the fetus during childbirth. At the lower end of the uterus is a ring of connective tissue called the cervix. The cervix opens into the vagina, a tube that leads to the outside of the body. The vagina is the receptacle for the penis during intercourse and also serves as the birth canal.

The external genitalia include the inner and outer labia, the vestibule, the hymen, and the clitoris. The hymen is a membrane that covers the vaginal orifice. The extent of coverage by the hymenal membrane varies from woman to woman. The clitoris is similar to the male glans, and it contains many nerve endings. As such it is the part of the female genitalia most responsive to sexual stimulation. Sexual excitement in the female brings about similar changes as in the male: the clitoris and labia become engorged with blood and sensitive to stimulation. During the stage called orgasm, the vagina and uterus contract rhythmically.

 


Related Discussions:- Explain the female reproductive system

Nerve fibres, NERV E FIBRES - Axon or dendrite of a nerve cell cove...

NERV E FIBRES - Axon or dendrite of a nerve cell covered with one, two or three sheaths is called nerve fibre. Dendrites are surrounded only by one sheath. An axon may b

Digestive system - pharynx, PHARYN X - Commom system between digestive...

PHARYN X - Commom system between digestive system and respiratory system. In it gullet and glottis present.Gullet leads to oesophagus. Glottis lead to trachea. Wall of p

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Forms of soil water, Forms of Soil Water Gravitational Water or Groun...

Forms of Soil Water Gravitational Water or Ground Water: After a heavy rain or irrigation, much of the water drains or sinks downwards. This is called gravitational water.

List a few applications of starches in the food industry, List a few applic...

List a few applications of starches in the food industry. A few applications of starches in the foods industry include thickener, a fat sparing agent, adhesive, binder,

What is gastrulation, Q. What is gastrulation? How during gastrulation are ...

Q. What is gastrulation? How during gastrulation are the first two germ layers formed? What are these germ layers? Gastrulation is the process through which a portion of the bl

Explain syndrome x as a effect of obesity, Explain Syndrome X as a Effect o...

Explain Syndrome X as a Effect of Obesity? People with intra-abdominal obesity with high waist- to- hip ratio are more prone to develop the metabolic syndrome X. This is charac

What is biological contaminants, Q. What is Biological Contaminants? Yo...

Q. What is Biological Contaminants? You may recall reading about food borne diseases caused by the consumption of contaminated food items in the last unit. In the

Adaptations to high wind velocity, Adaptations to high wind velocity Th...

Adaptations to high wind velocity The mechanical force of the wind and the grinding action of sand, dust, snow and other materials driven by it cause the plants to adapt themse

Periods of cultural evouition and modern man, PERIOD S OF CULTURAL EVOUITI...

PERIOD S OF CULTURAL EVOUITION AND MODERN MAN - Paleolithic period: Stone age. Age of tools of stones and bones, cave paintings. Mesolithi c period: Age of domesticati

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd