Explain the completed test - most probable number test, Biology

Assignment Help:

Explain the Completed Test - Most Probable Number Test?

Coliform colonies on EMB or Endo agar are further examined by completed test by inoculating lactose broth and nutrient agar slants from isolated colonies in confirmed test. Production of acid and gas in lactose broth and presence of gram negative rods in nutrient agar slants finally confirms the presence of E.coli in water sample and is considered to be a positive completed test.

Having gone through the discussion above, the 3 basic tests involved in detecting coliform in a water sample must be clearly understood by you. Make sure the procedure involved is clear, because we will try out these tests in the laboratory. Also a knowledge about the differential media, which are required for these tests is essential. So let us get to learn how to make these media.


Related Discussions:- Explain the completed test - most probable number test

Physical state of protoplasm, PHYSICAL STATE OF PROTOPLASM Several theo...

PHYSICAL STATE OF PROTOPLASM Several theories have been given about its physical structure - (i )  Granular Theory (Proposed by Altman, Hanstein, 1886) - Granules embed

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain functions of proteins, Explain Functions of proteins Functions ...

Explain Functions of proteins Functions of proteins are included herewith. These include: Source of energy: Constituent amino acids can be deaminated and metabolized to

Optic vesicle, Optic vesicle We have explained earlier that the presum...

Optic vesicle We have explained earlier that the presumptive material for the optic vesicles lies in qe eye field in the anterior region of the early neural plate. Experiments

Explain the types of basic forces, Q. Explain the types of basic forces? ...

Q. Explain the types of basic forces? Compression: This refers to the squeezing of the test material so that it still remains as a single undivided unit but may occupy less v

Pennetula, identifying characters of pennetula

identifying characters of pennetula

Community-based health insurance systems, Normal 0 false fals...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

Deficiency diseases-copper deficiency, Copper deficiency Copper deficie...

Copper deficiency Copper deficiency may be primary or secondary (conditional). Primary copper deficiency occurs due to its inadequate dietary intake; whereas secondary copper d

Living Environment- Cells, What happens to a cell when placed in a salt sol...

What happens to a cell when placed in a salt solution and then into distilled water?

Reciprocal crosses , RECIPROCAL CROSSES Similar results were obtained w...

RECIPROCAL CROSSES Similar results were obtained with reciprocal crosses also. A reciprocal crosses involves the same traits but carried by sexes opposite to those in the origi

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd